EMAIL THIS PAGE TO A FRIEND

KRT32

keratin 32

65 Gene Product Result for
Synonyms: HA2 HKA2 KRTHA2 hHa2
UniProtKB ID: Q14532
Gene ID:
Human(3882) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Mouse(16670) keratin 32
Rat(450230) keratin 32
cow(788182) keratin 32
dog(490985) keratin 32
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002278 Rosetta Predictions human pricing
NM_001008818 Rosetta Predictions rat pricing
NM_010665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002278 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333559 predicted 800
2 SASI_Hs02_00333560 predicted 1599
3 SASI_Hs02_00333561 predicted 1645
4 SASI_Hs02_00333562 predicted 1660
5 SASI_Hs02_00333563 predicted 1556
6 SASI_Hs01_00112891 predicted 565
7 SASI_Hs01_00112892 predicted 550
8 SASI_Hs02_00333564 predicted 1603
9 SASI_Hs02_00333565 predicted 544
10 SASI_Hs02_00333566 predicted 1678
11 SASI_Hs01_00112884 predicted 487
12 SASI_Hs01_00112885 predicted 959
13 SASI_Hs01_00112886 predicted 1406
14 SASI_Hs01_00112887 predicted 964
15 SASI_Hs01_00112888 predicted 923
16 SASI_Hs01_00112889 predicted 769
17 SASI_Hs01_00112890 predicted 554
18 SASI_Hs01_00112893 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008818 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082125 predicted 509
2 SASI_Rn01_00082126 predicted 862
3 SASI_Rn01_00082127 predicted 626
4 SASI_Rn01_00082128 predicted 688
5 SASI_Rn01_00082130 predicted 923
6 SASI_Rn01_00082131 predicted 714
7 SASI_Rn01_00082132 predicted 763
8 SASI_Rn01_00082133 predicted 506
9 SASI_Rn01_00082134 predicted 594
10 SASI_Rn02_00199310 predicted 946
11 SASI_Rn01_00082129 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160318 predicted 398
2 SASI_Mm01_00160319 predicted 848
3 SASI_Mm01_00160323 predicted 824
4 SASI_Mm01_00160324 predicted 381
5 SASI_Mm01_00160325 predicted 643
6 SASI_Mm01_00160326 predicted 391
7 SASI_Mm01_00160327 predicted 607
8 SASI_Mm02_00319087 predicted 1226
9 SASI_Mm02_00319088 predicted 482
10 SASI_Mm02_00319089 predicted 579
11 SASI_Mm01_00160320 predicted 764
12 SASI_Mm01_00160321 predicted 436
13 SASI_Mm01_00160322 predicted 533
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002278
KRT32 MISSION shRNA Bacterial Glycerol Stock
keratin 32
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-907s1c1
Sequence:CCGGCGTGGAGGAATGGTTCAATATCTCGAGATATTGAACCATTCCTCCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-905s1c1
Sequence:CCGGGACGTGGAGGAATGGTTCAATCTCGAGATTGAACCATTCCTCCACGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002278.2-1529s1c1
Sequence:CCGGCACCTGCAACAAGCTCTGATACTCGAGTATCAGAGCTTGTTGCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-490s1c1
Sequence:CCGGCCAGTCTCATTTCAGGACCATCTCGAGATGGTCCTGAAATGAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1746s21c1
Sequence:CCGGACAAGCCAATCCTACTCAATTCTCGAGAATTGAGTAGGATTGGCTTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1652s21c1
Sequence:CCGGAGAGCGTGTGTTCTTAGTTAACTCGAGTTAACTAAGAACACACGCTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-560s21c1
Sequence:CCGGATGGTTGTGAACATTGATAATCTCGAGATTATCAATGTTCACAACCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1772s21c1
Sequence:CCCGTAAGAGGAACGTGGGCAAATTCTCGAGAATTTGCCCACGTTCCTCTTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-352s21c1
Sequence:CCGGGGAAACCATGCAGTTCCTTAACTCGAGTTAAGGAACTGCATGGTTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-972s21c1
Sequence:CCGGAGCTTCAGAACTACCAGTCAGCTCGAGCTGACTGGTAGTTCTGAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002278
KRT32 MISSION shRNA shRNA Plasmid DNA
keratin 32
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-907s1c1
Sequence:CCGGCGTGGAGGAATGGTTCAATATCTCGAGATATTGAACCATTCCTCCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-905s1c1
Sequence:CCGGGACGTGGAGGAATGGTTCAATCTCGAGATTGAACCATTCCTCCACGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002278.2-1529s1c1
Sequence:CCGGCACCTGCAACAAGCTCTGATACTCGAGTATCAGAGCTTGTTGCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-490s1c1
Sequence:CCGGCCAGTCTCATTTCAGGACCATCTCGAGATGGTCCTGAAATGAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1746s21c1
Sequence:CCGGACAAGCCAATCCTACTCAATTCTCGAGAATTGAGTAGGATTGGCTTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1652s21c1
Sequence:CCGGAGAGCGTGTGTTCTTAGTTAACTCGAGTTAACTAAGAACACACGCTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-560s21c1
Sequence:CCGGATGGTTGTGAACATTGATAATCTCGAGATTATCAATGTTCACAACCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1772s21c1
Sequence:CCCGTAAGAGGAACGTGGGCAAATTCTCGAGAATTTGCCCACGTTCCTCTTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-352s21c1
Sequence:CCGGGGAAACCATGCAGTTCCTTAACTCGAGTTAAGGAACTGCATGGTTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-972s21c1
Sequence:CCGGAGCTTCAGAACTACCAGTCAGCTCGAGCTGACTGGTAGTTCTGAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002278
KRT32 MISSION shRNA Lentiviral Transduction Particles
keratin 32
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-907s1c1
Sequence:CCGGCGTGGAGGAATGGTTCAATATCTCGAGATATTGAACCATTCCTCCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-905s1c1
Sequence:CCGGGACGTGGAGGAATGGTTCAATCTCGAGATTGAACCATTCCTCCACGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113926    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002278.2-1529s1c1
Sequence:CCGGCACCTGCAACAAGCTCTGATACTCGAGTATCAGAGCTTGTTGCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002278.2-490s1c1
Sequence:CCGGCCAGTCTCATTTCAGGACCATCTCGAGATGGTCCTGAAATGAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434080    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1746s21c1
Sequence:CCGGACAAGCCAATCCTACTCAATTCTCGAGAATTGAGTAGGATTGGCTTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417223    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1652s21c1
Sequence:CCGGAGAGCGTGTGTTCTTAGTTAACTCGAGTTAACTAAGAACACACGCTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-560s21c1
Sequence:CCGGATGGTTGTGAACATTGATAATCTCGAGATTATCAATGTTCACAACCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426803    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002278.3-1772s21c1
Sequence:CCCGTAAGAGGAACGTGGGCAAATTCTCGAGAATTTGCCCACGTTCCTCTTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-352s21c1
Sequence:CCGGGGAAACCATGCAGTTCCTTAACTCGAGTTAAGGAACTGCATGGTTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002278.3-972s21c1
Sequence:CCGGAGCTTCAGAACTACCAGTCAGCTCGAGCTGACTGGTAGTTCTGAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010665
KRT32 MISSION shRNA Bacterial Glycerol Stock
keratin 32
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000091823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010665.1-1440s1c1
Sequence:CCGGCCTCCTCTATTTCCTTGGGTACTCGAGTACCCAAGGAAATAGAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-647s1c1
Sequence:CCGGCGCCTTAACATTGAGGTAGATCTCGAGATCTACCTCAATGTTAAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-530s1c1
Sequence:CCGGCTAACCCTGAATAAGGCTGATCTCGAGATCAGCCTTATTCAGGGTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-398s1c1
Sequence:CCGGGCAAGAATGATCGTGCACATTCTCGAGAATGTGCACGATCATTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010665
KRT32 MISSION shRNA shRNA Plasmid DNA
keratin 32
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000091823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010665.1-1440s1c1
Sequence:CCGGCCTCCTCTATTTCCTTGGGTACTCGAGTACCCAAGGAAATAGAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-647s1c1
Sequence:CCGGCGCCTTAACATTGAGGTAGATCTCGAGATCTACCTCAATGTTAAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-530s1c1
Sequence:CCGGCTAACCCTGAATAAGGCTGATCTCGAGATCAGCCTTATTCAGGGTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-398s1c1
Sequence:CCGGGCAAGAATGATCGTGCACATTCTCGAGAATGTGCACGATCATTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010665
KRT32 MISSION shRNA Lentiviral Transduction Particles
keratin 32
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000091823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010665.1-1440s1c1
Sequence:CCGGCCTCCTCTATTTCCTTGGGTACTCGAGTACCCAAGGAAATAGAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-647s1c1
Sequence:CCGGCGCCTTAACATTGAGGTAGATCTCGAGATCTACCTCAATGTTAAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-530s1c1
Sequence:CCGGCTAACCCTGAATAAGGCTGATCTCGAGATCAGCCTTATTCAGGGTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010665.1-398s1c1
Sequence:CCGGGCAAGAATGATCGTGCACATTCTCGAGAATGTGCACGATCATTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)