EMAIL THIS PAGE TO A FRIEND

KRT33A

keratin 33A

35 Gene Product Result for
Synonyms: HA3I Ha-3I K33A KRTHA3A Krt1-3 hHa3-I
UniProtKB ID: O76009, B2RA87, Q6NTB9, Q6ZZB9
Gene ID:
Human(3883) Summary: This gene encodes a member of the keratin gene family. This gene is one of multiple type I hair keratin genes that are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. As a type I hair keratin, the encoded protein is an acidic protein which heterodimerizes with type II keratins to form hair and nails. There are two isoforms of this protein, encoded by two separate genes, keratin 33A and keratin 33B. [provided by RefSeq, May 2012]
Mouse(71888) keratin 33A
Rat(303527) keratin 33A
Horse(100066898) keratin 33A
Horse(100066836) keratin 33A
dog(490991) keratin 33A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302695 ANTI-KT33A (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004138 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004138 Rosetta Predictions human pricing
NM_001008757 Rosetta Predictions rat pricing
XM_579205 Rosetta Predictions rat pricing
NM_027983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00082436 predicted 1171
2 SASI_Hs01_00082437 predicted 1188
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008757 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075304 predicted 342
2 SASI_Rn01_00075305 predicted 571
3 SASI_Rn01_00075306 predicted 1146
4 SASI_Rn01_00075307 predicted 1147
5 SASI_Rn01_00075308 predicted 1115
6 SASI_Rn01_00075309 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00123210 predicted 347
2 SASI_Rn01_00123211 predicted 570
3 SASI_Rn01_00123212 predicted 1160
4 SASI_Rn01_00123213 predicted 1157
5 SASI_Rn01_00123214 predicted 1115
6 SASI_Rn01_00123215 predicted 1159
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00196985 predicted 1375
2 SASI_Mm01_00196986 predicted 1304
3 SASI_Mm01_00196987 predicted 1381
4 SASI_Mm01_00196988 predicted 1406
5 SASI_Mm01_00196989 predicted 405
6 SASI_Mm01_00196992 predicted 1183
7 SASI_Mm01_00196993 predicted 1386
8 SASI_Mm01_00196994 predicted 407
9 SASI_Mm02_00333034 predicted 634
10 SASI_Mm02_00333035 predicted 1307
11 SASI_Mm01_00196990 predicted 941
12 SASI_Mm01_00196991 predicted 801
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027983
KRT33A MISSION shRNA Bacterial Glycerol Stock
keratin 33A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000450393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1393s21c1
Sequence:CCGGGTTCAAGCCTAGAGTGTATTTCTCGAGAAATACACTCTAGGCTTGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-1271s21c1
Sequence:CCGGTGTGCGTTAGAGACGCCATTGCTCGAGCAATGGCGTCTCTAACGCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1470s21c1
Sequence:CCGGACTCACACAAAGCCATATTTACTCGAGTAAATATGGCTTTGTGTGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027983.1-1519s1c1
Sequence:CCGGCTTCTCTAAATGTGACTGTAACTCGAGTTACAGTCACATTTAGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-933s1c1
Sequence:CCGGGCATGAACTGAGAAACTCTCTCTCGAGAGAGAGTTTCTCAGTTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1250s1c1
Sequence:CCGGGATGTGGACCTTGCAACACTTCTCGAGAAGTGTTGCAAGGTCCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1184s1c1
Sequence:CCGGCCACAACCAATGCTTGTGATACTCGAGTATCACAAGCATTGGTTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-414s1c1
Sequence:CCGGGATCTTGTGTGGCAAATCTGACTCGAGTCAGATTTGCCACACAAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-498s21c1
Sequence:CCGGTACGAGACAGAGCTTAGTCTGCTCGAGCAGACTAAGCTCTGTCTCGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1306s21c1
Sequence:CCGGGGATACCAGTTACATCGTAATCTCGAGATTACGATGTAACTGGTATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027983
KRT33A MISSION shRNA shRNA Plasmid DNA
keratin 33A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000450393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1393s21c1
Sequence:CCGGGTTCAAGCCTAGAGTGTATTTCTCGAGAAATACACTCTAGGCTTGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000449230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-1271s21c1
Sequence:CCGGTGTGCGTTAGAGACGCCATTGCTCGAGCAATGGCGTCTCTAACGCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1470s21c1
Sequence:CCGGACTCACACAAAGCCATATTTACTCGAGTAAATATGGCTTTGTGTGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027983.1-1519s1c1
Sequence:CCGGCTTCTCTAAATGTGACTGTAACTCGAGTTACAGTCACATTTAGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-933s1c1
Sequence:CCGGGCATGAACTGAGAAACTCTCTCTCGAGAGAGAGTTTCTCAGTTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1250s1c1
Sequence:CCGGGATGTGGACCTTGCAACACTTCTCGAGAAGTGTTGCAAGGTCCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1184s1c1
Sequence:CCGGCCACAACCAATGCTTGTGATACTCGAGTATCACAAGCATTGGTTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-414s1c1
Sequence:CCGGGATCTTGTGTGGCAAATCTGACTCGAGTCAGATTTGCCACACAAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-498s21c1
Sequence:CCGGTACGAGACAGAGCTTAGTCTGCTCGAGCAGACTAAGCTCTGTCTCGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000454739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1306s21c1
Sequence:CCGGGGATACCAGTTACATCGTAATCTCGAGATTACGATGTAACTGGTATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027983
KRT33A MISSION shRNA Lentiviral Transduction Particles
keratin 33A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000450393    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1393s21c1
Sequence:CCGGGTTCAAGCCTAGAGTGTATTTCTCGAGAAATACACTCTAGGCTTGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000449230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-1271s21c1
Sequence:CCGGTGTGCGTTAGAGACGCCATTGCTCGAGCAATGGCGTCTCTAACGCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1470s21c1
Sequence:CCGGACTCACACAAAGCCATATTTACTCGAGTAAATATGGCTTTGTGTGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089803    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027983.1-1519s1c1
Sequence:CCGGCTTCTCTAAATGTGACTGTAACTCGAGTTACAGTCACATTTAGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-933s1c1
Sequence:CCGGGCATGAACTGAGAAACTCTCTCTCGAGAGAGAGTTTCTCAGTTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1250s1c1
Sequence:CCGGGATGTGGACCTTGCAACACTTCTCGAGAAGTGTTGCAAGGTCCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-1184s1c1
Sequence:CCGGCCACAACCAATGCTTGTGATACTCGAGTATCACAAGCATTGGTTGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027983.1-414s1c1
Sequence:CCGGGATCTTGTGTGGCAAATCTGACTCGAGTCAGATTTGCCACACAAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027983.3-498s21c1
Sequence:CCGGTACGAGACAGAGCTTAGTCTGCTCGAGCAGACTAAGCTCTGTCTCGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000454739    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027983.3-1306s21c1
Sequence:CCGGGGATACCAGTTACATCGTAATCTCGAGATTACGATGTAACTGGTATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004138
KRT33A MISSION shRNA Bacterial Glycerol Stock
keratin 33A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000420943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-1158s21c1
Sequence:CCGGCAACCAATGCATGTGACAAGTCTCGAGACTTGTCACATGCATTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-613s21c1
Sequence:CCGGGAACCATGAGCAGGAGGTTAACTCGAGTTAACCTCCTGCTCATGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-450s1c1
Sequence:CCGGCAGATGACTTCAGGACCAAATCTCGAGATTTGGTCCTGAAGTCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-389s1c1
Sequence:CCGGCTGTGCAGCAAGTCTGAGAATCTCGAGATTCTCAGACTTGCTGCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-451s1c1
Sequence:CCGGAGATGACTTCAGGACCAAATACTCGAGTATTTGGTCCTGAAGTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-187s1c1
Sequence:CCGGCTCCTTCAATGGCAGTGAGAACTCGAGTTCTCACTGCCATTGAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-1078s1c1
Sequence:CCGGGCGGCTGGAGTGTGAGATCAACTCGAGTTGATCTCACACTCCAGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004138
KRT33A MISSION shRNA shRNA Plasmid DNA
keratin 33A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000420943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-1158s21c1
Sequence:CCGGCAACCAATGCATGTGACAAGTCTCGAGACTTGTCACATGCATTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-613s21c1
Sequence:CCGGGAACCATGAGCAGGAGGTTAACTCGAGTTAACCTCCTGCTCATGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-450s1c1
Sequence:CCGGCAGATGACTTCAGGACCAAATCTCGAGATTTGGTCCTGAAGTCATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-389s1c1
Sequence:CCGGCTGTGCAGCAAGTCTGAGAATCTCGAGATTCTCAGACTTGCTGCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-451s1c1
Sequence:CCGGAGATGACTTCAGGACCAAATACTCGAGTATTTGGTCCTGAAGTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-187s1c1
Sequence:CCGGCTCCTTCAATGGCAGTGAGAACTCGAGTTCTCACTGCCATTGAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-1078s1c1
Sequence:CCGGGCGGCTGGAGTGTGAGATCAACTCGAGTTGATCTCACACTCCAGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004138
KRT33A MISSION shRNA Lentiviral Transduction Particles
keratin 33A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000420943    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-1158s21c1
Sequence:CCGGCAACCAATGCATGTGACAAGTCTCGAGACTTGTCACATGCATTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004138.2-613s21c1
Sequence:CCGGGAACCATGAGCAGGAGGTTAACTCGAGTTAACCTCCTGCTCATGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-450s1c1
Sequence:CCGGCAGATGACTTCAGGACCAAATCTCGAGATTTGGTCCTGAAGTCATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-389s1c1
Sequence:CCGGCTGTGCAGCAAGTCTGAGAATCTCGAGATTCTCAGACTTGCTGCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-451s1c1
Sequence:CCGGAGATGACTTCAGGACCAAATACTCGAGTATTTGGTCCTGAAGTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-187s1c1
Sequence:CCGGCTCCTTCAATGGCAGTGAGAACTCGAGTTCTCACTGCCATTGAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004138.2-1078s1c1
Sequence:CCGGGCGGCTGGAGTGTGAGATCAACTCGAGTTGATCTCACACTCCAGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)