EMAIL THIS PAGE TO A FRIEND

KRT35

keratin 35

52 Gene Product Result for
Synonyms: HA5 Ha-5 KRTHA5 hHa5
UniProtKB ID: Q92764, O76012, Q92651
Gene ID:
Human(3886) Summary: The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Mouse(53617) keratin 35
Rat(287697) keratin 35
cow(536311) keratin 35
dog(607814) keratin 35
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002280 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002280 Rosetta Predictions human pricing
NM_001008820 Rosetta Predictions rat pricing
XM_579217 Rosetta Predictions rat pricing
NM_016880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108328 predicted 1029
2 SASI_Hs01_00108329 predicted 891
3 SASI_Hs01_00108331 predicted 811
4 SASI_Hs01_00108332 predicted 1304
5 SASI_Hs01_00108333 predicted 506
6 SASI_Hs01_00108334 predicted 260
7 SASI_Hs01_00108335 predicted 1065
8 SASI_Hs01_00108337 predicted 1577
9 SASI_Hs02_00333567 predicted 114
10 SASI_Hs02_00333568 predicted 1489
11 SASI_Hs01_00108330 predicted 730
12 SASI_Hs01_00108336 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093273 predicted 490
2 SASI_Rn01_00093275 predicted 1065
3 SASI_Rn01_00093276 predicted 549
4 SASI_Rn01_00093277 predicted 677
5 SASI_Rn01_00093278 predicted 666
6 SASI_Rn01_00093279 predicted 986
7 SASI_Rn02_00199311 predicted 336
8 SASI_Rn01_00093280 predicted 909
9 SASI_Rn01_00093281 predicted 852
10 SASI_Rn01_00093282 predicted 295
11 SASI_Rn01_00093274 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00176219 predicted 501
2 SASI_Rn01_00176220 predicted 337
3 SASI_Rn01_00176221 predicted 1065
4 SASI_Rn01_00176222 predicted 559
5 SASI_Rn01_00176223 predicted 682
6 SASI_Rn01_00176224 predicted 674
7 SASI_Rn01_00176225 predicted 996
8 SASI_Rn01_00176226 predicted 920
9 SASI_Rn01_00176227 predicted 858
10 SASI_Rn01_00176228 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123582 predicted 1479
2 SASI_Mm01_00123583 predicted 471
3 SASI_Mm01_00123584 predicted 711
4 SASI_Mm01_00123585 predicted 1106
5 SASI_Mm01_00123586 predicted 972
6 SASI_Mm01_00123587 predicted 582
7 SASI_Mm01_00123588 predicted 1509
8 SASI_Mm01_00123589 predicted 1281
9 SASI_Mm01_00123590 predicted 418
10 SASI_Mm01_00123591 predicted 642
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002280
KRT35 MISSION shRNA Bacterial Glycerol Stock
keratin 35
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-1275s21c1
Sequence:CCGGACCCATGTGCACCTGACTACTCTCGAGAGTAGTCAGGTGCACATGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-119s21c1
Sequence:CCGGACTCGTGTGTCCGCAATGTACCTCGAGGTACATTGCGGACACACGAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-466s21c1
Sequence:CCGGCCCTGACTACCAGTCCTACTTCTCGAGAAGTAGGACTGGTAGTCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-862s21c1
Sequence:CCGGTGAAACCCTGGTGGAGAATAACTCGAGTTATTCTCCACCAGGGTTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002280.3-1823s1c1
Sequence:CCGGGCAAATACATGCCCTAAAGTTCTCGAGAACTTTAGGGCATGTATTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1309s1c1
Sequence:CCGGGCACAGCATGAGAGATGCTTTCTCGAGAAAGCATCTCTCATGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1094s1c1
Sequence:CCGGCCTGTTGACCTGAACCGAGTTCTCGAGAACTCGGTTCAGGTCAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1575s1c1
Sequence:CCGGCCTCCAAGTCATGCCTTCCCTCTCGAGAGGGAAGGCATGACTTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1314s1c1
Sequence:CCGGGCATGAGAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002280
KRT35 MISSION shRNA shRNA Plasmid DNA
keratin 35
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-1275s21c1
Sequence:CCGGACCCATGTGCACCTGACTACTCTCGAGAGTAGTCAGGTGCACATGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-119s21c1
Sequence:CCGGACTCGTGTGTCCGCAATGTACCTCGAGGTACATTGCGGACACACGAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-466s21c1
Sequence:CCGGCCCTGACTACCAGTCCTACTTCTCGAGAAGTAGGACTGGTAGTCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-862s21c1
Sequence:CCGGTGAAACCCTGGTGGAGAATAACTCGAGTTATTCTCCACCAGGGTTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002280.3-1823s1c1
Sequence:CCGGGCAAATACATGCCCTAAAGTTCTCGAGAACTTTAGGGCATGTATTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1309s1c1
Sequence:CCGGGCACAGCATGAGAGATGCTTTCTCGAGAAAGCATCTCTCATGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1094s1c1
Sequence:CCGGCCTGTTGACCTGAACCGAGTTCTCGAGAACTCGGTTCAGGTCAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1575s1c1
Sequence:CCGGCCTCCAAGTCATGCCTTCCCTCTCGAGAGGGAAGGCATGACTTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1314s1c1
Sequence:CCGGGCATGAGAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002280
KRT35 MISSION shRNA Lentiviral Transduction Particles
keratin 35
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438599    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-1275s21c1
Sequence:CCGGACCCATGTGCACCTGACTACTCTCGAGAGTAGTCAGGTGCACATGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-119s21c1
Sequence:CCGGACTCGTGTGTCCGCAATGTACCTCGAGGTACATTGCGGACACACGAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-466s21c1
Sequence:CCGGCCCTGACTACCAGTCCTACTTCTCGAGAAGTAGGACTGGTAGTCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002280.4-862s21c1
Sequence:CCGGTGAAACCCTGGTGGAGAATAACTCGAGTTATTCTCCACCAGGGTTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117022    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002280.3-1823s1c1
Sequence:CCGGGCAAATACATGCCCTAAAGTTCTCGAGAACTTTAGGGCATGTATTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1309s1c1
Sequence:CCGGGCACAGCATGAGAGATGCTTTCTCGAGAAAGCATCTCTCATGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1094s1c1
Sequence:CCGGCCTGTTGACCTGAACCGAGTTCTCGAGAACTCGGTTCAGGTCAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1575s1c1
Sequence:CCGGCCTCCAAGTCATGCCTTCCCTCTCGAGAGGGAAGGCATGACTTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002280.3-1314s1c1
Sequence:CCGGGCATGAGAGATGCTTTGGAATCTCGAGATTCCAAAGCATCTCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016880
KRT35 MISSION shRNA Bacterial Glycerol Stock
keratin 35
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016880.1-1459s1c1
Sequence:CCGGCCTCCAGTCAATCTGACTGTTCTCGAGAACAGTCAGATTGACTGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-589s1c1
Sequence:CCGGACCAAGTATGAGACTGAGGTTCTCGAGAACCTCAGTCTCATACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-966s1c1
Sequence:CCGGCCAGTCGGACATCATTGAGTTCTCGAGAACTCAATGATGTCCGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-784s1c1
Sequence:CCGGCGGCTCAATGTTGAGGTGGATCTCGAGATCCACCTCAACATTGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-176s1c1
Sequence:CCGGCCCGGAGTTTCTCCGTGTGTTCTCGAGAACACACGGAGAAACTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016880
KRT35 MISSION shRNA shRNA Plasmid DNA
keratin 35
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016880.1-1459s1c1
Sequence:CCGGCCTCCAGTCAATCTGACTGTTCTCGAGAACAGTCAGATTGACTGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-589s1c1
Sequence:CCGGACCAAGTATGAGACTGAGGTTCTCGAGAACCTCAGTCTCATACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-966s1c1
Sequence:CCGGCCAGTCGGACATCATTGAGTTCTCGAGAACTCAATGATGTCCGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-784s1c1
Sequence:CCGGCGGCTCAATGTTGAGGTGGATCTCGAGATCCACCTCAACATTGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-176s1c1
Sequence:CCGGCCCGGAGTTTCTCCGTGTGTTCTCGAGAACACACGGAGAAACTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016880
KRT35 MISSION shRNA Lentiviral Transduction Particles
keratin 35
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016880.1-1459s1c1
Sequence:CCGGCCTCCAGTCAATCTGACTGTTCTCGAGAACAGTCAGATTGACTGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-589s1c1
Sequence:CCGGACCAAGTATGAGACTGAGGTTCTCGAGAACCTCAGTCTCATACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-966s1c1
Sequence:CCGGCCAGTCGGACATCATTGAGTTCTCGAGAACTCAATGATGTCCGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-784s1c1
Sequence:CCGGCGGCTCAATGTTGAGGTGGATCTCGAGATCCACCTCAACATTGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016880.1-176s1c1
Sequence:CCGGCCCGGAGTTTCTCCGTGTGTTCTCGAGAACACACGGAGAAACTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)