EMAIL THIS PAGE TO A FRIEND

KRT36

keratin 36

87 Gene Product Result for
Synonyms: HA6 KRTHA6 hHa6
UniProtKB ID: O76013, Q86XG4
Gene ID:
Human(8689) Summary: The protein encoded by this gene is a member of the keratin gene family. This type I hair keratin is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Mouse(16673) keratin 36
Rat(287698) keratin 36
dog(490984) keratin 36
cow(520668) keratin 36
Horse(100066701) keratin 36
sheep(101117175) keratin 36
sheep(100528015) keratin 36
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003771 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003771 Rosetta Predictions human pricing
NM_001008759 Rosetta Predictions rat pricing
XM_579207 Rosetta Predictions rat pricing
NR_003957 Rosetta Predictions mouse pricing
XM_894886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099852 predicted 761
2 SASI_Hs01_00099853 predicted 936
3 SASI_Hs01_00099856 predicted 1240
4 SASI_Hs01_00099858 predicted 1225
5 SASI_Hs01_00099859 predicted 972
6 SASI_Hs01_00099860 predicted 1126
7 SASI_Hs01_00099861 predicted 521
8 SASI_Hs02_00336263 predicted 975
9 SASI_Hs02_00336264 predicted 777
10 SASI_Hs02_00336265 predicted 932
11 SASI_Hs01_00099854 predicted 837
12 SASI_Hs01_00099855 predicted 730
13 SASI_Hs01_00099857 predicted 468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072808 predicted 464
2 SASI_Rn01_00072809 predicted 1034
3 SASI_Rn01_00072810 predicted 1099
4 SASI_Rn02_00199259 predicted 957
5 SASI_Rn01_00072811 predicted 359
6 SASI_Rn01_00072812 predicted 993
7 SASI_Rn01_00072813 predicted 771
8 SASI_Rn01_00072815 predicted 1133
9 SASI_Rn01_00072816 predicted 1091
10 SASI_Rn01_00072817 predicted 994
11 SASI_Rn01_00072814 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579207 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00131063 predicted 427
2 SASI_Rn01_00131064 predicted 364
3 SASI_Rn01_00131065 predicted 369
4 SASI_Rn01_00131066 predicted 270
5 SASI_Rn01_00131067 predicted 437
6 SASI_Rn01_00131068 predicted 278
7 SASI_Rn01_00131069 predicted 377
8 SASI_Rn01_00131070 predicted 430
9 SASI_Rn01_00131071 predicted 16
10 SASI_Rn01_00131072 predicted 1108
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003957 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353926 predicted 1320
2 SASI_Mm02_00353927 predicted 2949
3 SASI_Mm02_00353928 predicted 3524
4 SASI_Mm02_00353929 predicted 1261
5 SASI_Mm02_00353930 predicted 3407
6 SASI_Mm02_00353931 predicted 3619
7 SASI_Mm02_00353932 predicted 971
8 SASI_Mm02_00353933 predicted 1260
9 SASI_Mm02_00353934 predicted 1755
10 SASI_Mm02_00353935 predicted 3453
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273730 predicted 1325
2 SASI_Mm01_00273731 predicted 1270
3 SASI_Mm01_00273732 predicted 1017
4 SASI_Mm01_00273733 predicted 1288
5 SASI_Mm01_00273734 predicted 977
6 SASI_Mm01_00273735 predicted 1266
7 SASI_Mm01_00273736 predicted 1269
8 SASI_Mm01_00273737 predicted 1273
9 SASI_Mm01_00273738 predicted 1153
10 SASI_Mm01_00273739 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003771
KRT36 MISSION shRNA Bacterial Glycerol Stock
keratin 36
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-463s1c1
Sequence:CCGGCTGCTGACTAAGTCTGAGAATCTCGAGATTCTCAGACTTAGTCAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-983s1c1
Sequence:CCGGGCATGCGGAATTCCTTGGAATCTCGAGATTCCAAGGAATTCCGCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-462s1c1
Sequence:CCGGCCTGCTGACTAAGTCTGAGAACTCGAGTTCTCAGACTTAGTCAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-1232s1c1
Sequence:CCGGCGGCATGCAAGCCTGTTATTACTCGAGTAATAACAGGCTTGCATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-762s1c1
Sequence:CCGGCCCAGTGGATCTCAACAAGATCTCGAGATCTTGTTGAGATCCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-386s21c1
Sequence:CCGGACGAGTTTCAGATCCCATACACTCGAGTGTATGGGATCTGAAACTCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-1336s21c1
Sequence:CCGGATCACCGAGGAGATCAGAGATCTCGAGATCTCTGATCTCCTCGGTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-489s21c1
Sequence:CCGGGCTGGTCCTGCAGATTGATAACTCGAGTTATCAATCTGCAGGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-26s21c1
Sequence:CCGGCCTTCTCCACTGGGTCTATCACTCGAGTGATAGACCCAGTGGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003771
KRT36 MISSION shRNA shRNA Plasmid DNA
keratin 36
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-463s1c1
Sequence:CCGGCTGCTGACTAAGTCTGAGAATCTCGAGATTCTCAGACTTAGTCAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-983s1c1
Sequence:CCGGGCATGCGGAATTCCTTGGAATCTCGAGATTCCAAGGAATTCCGCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-462s1c1
Sequence:CCGGCCTGCTGACTAAGTCTGAGAACTCGAGTTCTCAGACTTAGTCAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-1232s1c1
Sequence:CCGGCGGCATGCAAGCCTGTTATTACTCGAGTAATAACAGGCTTGCATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-762s1c1
Sequence:CCGGCCCAGTGGATCTCAACAAGATCTCGAGATCTTGTTGAGATCCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-386s21c1
Sequence:CCGGACGAGTTTCAGATCCCATACACTCGAGTGTATGGGATCTGAAACTCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-1336s21c1
Sequence:CCGGATCACCGAGGAGATCAGAGATCTCGAGATCTCTGATCTCCTCGGTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-489s21c1
Sequence:CCGGGCTGGTCCTGCAGATTGATAACTCGAGTTATCAATCTGCAGGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-26s21c1
Sequence:CCGGCCTTCTCCACTGGGTCTATCACTCGAGTGATAGACCCAGTGGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003771
KRT36 MISSION shRNA Lentiviral Transduction Particles
keratin 36
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-463s1c1
Sequence:CCGGCTGCTGACTAAGTCTGAGAATCTCGAGATTCTCAGACTTAGTCAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-983s1c1
Sequence:CCGGGCATGCGGAATTCCTTGGAATCTCGAGATTCCAAGGAATTCCGCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-462s1c1
Sequence:CCGGCCTGCTGACTAAGTCTGAGAACTCGAGTTCTCAGACTTAGTCAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-1232s1c1
Sequence:CCGGCGGCATGCAAGCCTGTTATTACTCGAGTAATAACAGGCTTGCATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003771.3-762s1c1
Sequence:CCGGCCCAGTGGATCTCAACAAGATCTCGAGATCTTGTTGAGATCCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-386s21c1
Sequence:CCGGACGAGTTTCAGATCCCATACACTCGAGTGTATGGGATCTGAAACTCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-1336s21c1
Sequence:CCGGATCACCGAGGAGATCAGAGATCTCGAGATCTCTGATCTCCTCGGTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-489s21c1
Sequence:CCGGGCTGGTCCTGCAGATTGATAACTCGAGTTATCAATCTGCAGGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003771.4-26s21c1
Sequence:CCGGCCTTCTCCACTGGGTCTATCACTCGAGTGATAGACCCAGTGGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)