EMAIL THIS PAGE TO A FRIEND

KRT37

keratin 37

17 Gene Product Result for
Synonyms: HA7 K37 KRTHA7
UniProtKB ID: O76014
Gene ID:
Human(8688) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
Horse(100066792) keratin 37
dog(607848) keratin 37
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003770 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003770 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003770 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003770 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003770 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059506 predicted 285
2 SASI_Hs01_00059507 predicted 494
3 SASI_Hs01_00059508 predicted 657
4 SASI_Hs01_00059509 predicted 1131
5 SASI_Hs01_00059510 predicted 1413
6 SASI_Hs01_00059511 predicted 1459
7 SASI_Hs01_00059512 predicted 1410
8 SASI_Hs01_00059513 predicted 1143
9 SASI_Hs01_00059514 predicted 1461
10 SASI_Hs02_00336262 predicted 286
11 SASI_Hs01_00059515 predicted 1583
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003770
KRT37 MISSION shRNA Bacterial Glycerol Stock
keratin 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003770.4-1507s21c1
Sequence:CCGGATCAACCGGTAGCAGATACTTCTCGAGAAGTATCTGCTACCGGTTGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-1396s21c1
Sequence:CCGGGATTCTGAAGGCCCGAGTTAGCTCGAGCTAACTCGGGCCTTCAGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-259s21c1
Sequence:CCGGCAACCAGTCACACTGCTTGTCCTCGAGGACAAGCAGTGTGACTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003770.4-1546s1c1
Sequence:CCGGCCTATGCCTCTAAGCTGTATTCTCGAGAATACAGCTTAGAGGCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-99s1c1
Sequence:CCGGCCTGGAGCAAGAAATGTCTTTCTCGAGAAAGACATTTCTTGCTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1230s1c1
Sequence:CCGGGCCCGGTTGGAGAACGAGATTCTCGAGAATCTCGTTCTCCAACCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-500s1c1
Sequence:CCGGCCAGTCCTACTTCCGTACAATCTCGAGATTGTACGGAAGTAGGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1318s1c1
Sequence:CCGGCCTCCTGTACTTCTTGTCCAACTCGAGTTGGACAAGAAGTACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003770
KRT37 MISSION shRNA shRNA Plasmid DNA
keratin 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003770.4-1507s21c1
Sequence:CCGGATCAACCGGTAGCAGATACTTCTCGAGAAGTATCTGCTACCGGTTGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-1396s21c1
Sequence:CCGGGATTCTGAAGGCCCGAGTTAGCTCGAGCTAACTCGGGCCTTCAGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-259s21c1
Sequence:CCGGCAACCAGTCACACTGCTTGTCCTCGAGGACAAGCAGTGTGACTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003770.4-1546s1c1
Sequence:CCGGCCTATGCCTCTAAGCTGTATTCTCGAGAATACAGCTTAGAGGCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-99s1c1
Sequence:CCGGCCTGGAGCAAGAAATGTCTTTCTCGAGAAAGACATTTCTTGCTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1230s1c1
Sequence:CCGGGCCCGGTTGGAGAACGAGATTCTCGAGAATCTCGTTCTCCAACCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-500s1c1
Sequence:CCGGCCAGTCCTACTTCCGTACAATCTCGAGATTGTACGGAAGTAGGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1318s1c1
Sequence:CCGGCCTCCTGTACTTCTTGTCCAACTCGAGTTGGACAAGAAGTACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003770
KRT37 MISSION shRNA Lentiviral Transduction Particles
keratin 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003770.4-1507s21c1
Sequence:CCGGATCAACCGGTAGCAGATACTTCTCGAGAAGTATCTGCTACCGGTTGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-1396s21c1
Sequence:CCGGGATTCTGAAGGCCCGAGTTAGCTCGAGCTAACTCGGGCCTTCAGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003770.4-259s21c1
Sequence:CCGGCAACCAGTCACACTGCTTGTCCTCGAGGACAAGCAGTGTGACTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117247    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003770.4-1546s1c1
Sequence:CCGGCCTATGCCTCTAAGCTGTATTCTCGAGAATACAGCTTAGAGGCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-99s1c1
Sequence:CCGGCCTGGAGCAAGAAATGTCTTTCTCGAGAAAGACATTTCTTGCTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1230s1c1
Sequence:CCGGGCCCGGTTGGAGAACGAGATTCTCGAGAATCTCGTTCTCCAACCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-500s1c1
Sequence:CCGGCCAGTCCTACTTCCGTACAATCTCGAGATTGTACGGAAGTAGGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003770.4-1318s1c1
Sequence:CCGGCCTCCTGTACTTCTTGTCCAACTCGAGTTGGACAAGAAGTACAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)