EMAIL THIS PAGE TO A FRIEND

KRT38

keratin 38

17 Gene Product Result for
Synonyms: HA8 KRTHA8 hHa8
UniProtKB ID: O76015, A2RRM5, Q6A164
Gene ID:
Human(8687) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type I hair keratin, it is an acidic protein which heterodimerizes with type II keratins to form hair and nails. The type I hair keratins are clustered in a region of chromosome 17q12-q21 and have the same direction of transcription. [provided by RefSeq, Jul 2008]
dog(490986) keratin 38
cow(515000) keratin 38
dog(490987) keratin 38
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301559 ANTI-KRT38 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006771 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006771 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006771 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU016461 MISSION® esiRNA esiRNA targeting human KRT38 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006771 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006771 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00342279 predicted 1896
2 SASI_Hs01_00124129 predicted 2068
3 SASI_Hs01_00124130 predicted 1840
4 SASI_Hs01_00124131 predicted 1838
5 SASI_Hs01_00124132 predicted 1829
6 SASI_Hs01_00124133 predicted 875
7 SASI_Hs01_00124134 predicted 1784
8 SASI_Hs01_00124136 predicted 1842
9 SASI_Hs01_00124137 predicted 1870
10 SASI_Hs02_00342280 predicted 673
11 SASI_Hs01_00124135 predicted 1041
12 SASI_Hs01_00124138 predicted 1878
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006771
KRT38 MISSION shRNA Bacterial Glycerol Stock
keratin 38
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-940s1c1
Sequence:CCGGGCCAGGCTGATTGTACAAATTCTCGAGAATTTGTACAATCAGCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-670s1c1
Sequence:CCGGTGCCACATTCCTGGCAACATTCTCGAGAATGTTGCCAGGAATGTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006771.3-2188s1c1
Sequence:CCGGCCCACATTTCTTGGGTTGTTTCTCGAGAAACAACCCAAGAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-493s1c1
Sequence:CCGGTCTGTCTCTCCCATCGACATTCTCGAGAATGTCGATGGGAGAGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-876s1c1
Sequence:CCGGCCAGTCTTACTTCCACACCATCTCGAGATGGTGTGGAAGTAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2105s21c1
Sequence:CCGGACTTCAAGAACACCAACTTTACTCGAGTAAAGTTGGTGTTCTTGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-1927s21c1
Sequence:CCGGCAGTGGAATCTTGATGGAAATCTCGAGATTTCCATCAAGATTCCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2031s21c1
Sequence:CCGGATCTGGATTGGAGAGGCATAACTCGAGTTATGCCTCTCCAATCCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006771
KRT38 MISSION shRNA shRNA Plasmid DNA
keratin 38
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-940s1c1
Sequence:CCGGGCCAGGCTGATTGTACAAATTCTCGAGAATTTGTACAATCAGCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-670s1c1
Sequence:CCGGTGCCACATTCCTGGCAACATTCTCGAGAATGTTGCCAGGAATGTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006771.3-2188s1c1
Sequence:CCGGCCCACATTTCTTGGGTTGTTTCTCGAGAAACAACCCAAGAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-493s1c1
Sequence:CCGGTCTGTCTCTCCCATCGACATTCTCGAGAATGTCGATGGGAGAGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-876s1c1
Sequence:CCGGCCAGTCTTACTTCCACACCATCTCGAGATGGTGTGGAAGTAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2105s21c1
Sequence:CCGGACTTCAAGAACACCAACTTTACTCGAGTAAAGTTGGTGTTCTTGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-1927s21c1
Sequence:CCGGCAGTGGAATCTTGATGGAAATCTCGAGATTTCCATCAAGATTCCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2031s21c1
Sequence:CCGGATCTGGATTGGAGAGGCATAACTCGAGTTATGCCTCTCCAATCCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006771
KRT38 MISSION shRNA Lentiviral Transduction Particles
keratin 38
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-940s1c1
Sequence:CCGGGCCAGGCTGATTGTACAAATTCTCGAGAATTTGTACAATCAGCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-670s1c1
Sequence:CCGGTGCCACATTCCTGGCAACATTCTCGAGAATGTTGCCAGGAATGTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116297    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006771.3-2188s1c1
Sequence:CCGGCCCACATTTCTTGGGTTGTTTCTCGAGAAACAACCCAAGAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-493s1c1
Sequence:CCGGTCTGTCTCTCCCATCGACATTCTCGAGAATGTCGATGGGAGAGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006771.3-876s1c1
Sequence:CCGGCCAGTCTTACTTCCACACCATCTCGAGATGGTGTGGAAGTAAGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435100    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2105s21c1
Sequence:CCGGACTTCAAGAACACCAACTTTACTCGAGTAAAGTTGGTGTTCTTGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434805    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-1927s21c1
Sequence:CCGGCAGTGGAATCTTGATGGAAATCTCGAGATTTCCATCAAGATTCCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006771.3-2031s21c1
Sequence:CCGGATCTGGATTGGAGAGGCATAACTCGAGTTATGCCTCTCCAATCCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)