EMAIL THIS PAGE TO A FRIEND

KRT39

keratin 39

61 Gene Product Result for
Synonyms: CK-39 K39 KA35
UniProtKB ID: Q6A163, B2RXK6, Q6IFU6
Gene ID:
Human(390792) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Mouse(237934) keratin 39
Rat(303523) keratin 39
cow(537917) keratin 39
Horse(100067401) keratin 39
dog(491004) keratin 39
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301077 ANTI-KRT39 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB1411901 ANTI-KRT39 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_213656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_213656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_213730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_213656 Rosetta Predictions human pricing
NM_001004130 Rosetta Predictions rat pricing
XM_579129 Rosetta Predictions rat pricing
NM_213730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213283 predicted 905
2 SASI_Hs01_00213284 predicted 461
3 SASI_Hs01_00213286 predicted 811
4 SASI_Hs01_00213287 predicted 738
5 SASI_Hs01_00213289 predicted 451
6 SASI_Hs01_00213290 predicted 885
7 SASI_Hs01_00213291 predicted 386
8 SASI_Hs01_00213292 predicted 595
9 SASI_Hs02_00374353 predicted 421
10 SASI_Hs02_00374354 predicted 383
11 SASI_Hs01_00213285 predicted 739
12 SASI_Hs01_00213288 predicted 545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088469 predicted 295
2 SASI_Rn01_00088471 predicted 1112
3 SASI_Rn01_00088472 predicted 252
4 SASI_Rn01_00088474 predicted 334
5 SASI_Rn01_00088475 predicted 828
6 SASI_Rn01_00088476 predicted 893
7 SASI_Rn01_00088477 predicted 985
8 SASI_Rn01_00088478 predicted 815
9 SASI_Rn02_00198159 predicted 811
10 SASI_Rn02_00198160 predicted 1101
11 SASI_Rn01_00088470 predicted 689
12 SASI_Rn01_00088473 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579129 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190802 predicted 303
2 SASI_Rn01_00190803 predicted 924
3 SASI_Rn01_00190804 predicted 242
4 SASI_Rn01_00190805 predicted 1119
5 SASI_Rn01_00190806 predicted 257
6 SASI_Rn01_00190807 predicted 831
7 SASI_Rn01_00190808 predicted 895
8 SASI_Rn01_00190809 predicted 988
9 SASI_Rn01_00190810 predicted 822
10 SASI_Rn01_00190811 predicted 1004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044644 predicted 253
2 SASI_Mm01_00044645 predicted 687
3 SASI_Mm01_00044646 predicted 1118
4 SASI_Mm01_00044649 predicted 1183
5 SASI_Mm01_00044650 predicted 1205
6 SASI_Mm02_00352306 predicted 891
7 SASI_Mm01_00044651 predicted 254
8 SASI_Mm02_00352307 predicted 818
9 SASI_Mm01_00044652 predicted 938
10 SASI_Mm01_00044653 predicted 934
11 SASI_Mm01_00044647 predicted 446
12 SASI_Mm01_00044648 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213656
KRT39 MISSION shRNA Bacterial Glycerol Stock
keratin 39
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213656.3-890s21c1
Sequence:CCGGAGTGGTTCAACACGCAGATAGCTCGAGCTATCTGCGTGTTGAACCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-1019s1c1
Sequence:CCGGCCCAGCATCGAATGAGAGATTCTCGAGAATCTCTCATTCGATGCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-92s1c1
Sequence:CCGGGCTCTAGGATTACAAATGTTACTCGAGTAACATTTGTAATCCTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213656.2-1539s1c1
Sequence:CCGGCATTTATGAAACAGAGGCCAACTCGAGTTGGCCTCTGTTTCATAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-444s1c1
Sequence:CCGGCCCTGTTCTATGTCCTGATTACTCGAGTAATCAGGACATAGAACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-568s1c1
Sequence:CCGGGCAGATGACTTGAGAGCCAAACTCGAGTTTGGCTCTCAAGTCATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213656
KRT39 MISSION shRNA shRNA Plasmid DNA
keratin 39
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213656.3-890s21c1
Sequence:CCGGAGTGGTTCAACACGCAGATAGCTCGAGCTATCTGCGTGTTGAACCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-1019s1c1
Sequence:CCGGCCCAGCATCGAATGAGAGATTCTCGAGAATCTCTCATTCGATGCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-92s1c1
Sequence:CCGGGCTCTAGGATTACAAATGTTACTCGAGTAACATTTGTAATCCTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213656.2-1539s1c1
Sequence:CCGGCATTTATGAAACAGAGGCCAACTCGAGTTGGCCTCTGTTTCATAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-444s1c1
Sequence:CCGGCCCTGTTCTATGTCCTGATTACTCGAGTAATCAGGACATAGAACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-568s1c1
Sequence:CCGGGCAGATGACTTGAGAGCCAAACTCGAGTTTGGCTCTCAAGTCATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213656
KRT39 MISSION shRNA Lentiviral Transduction Particles
keratin 39
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442626    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_213656.3-890s21c1
Sequence:CCGGAGTGGTTCAACACGCAGATAGCTCGAGCTATCTGCGTGTTGAACCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-1019s1c1
Sequence:CCGGCCCAGCATCGAATGAGAGATTCTCGAGAATCTCTCATTCGATGCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-92s1c1
Sequence:CCGGGCTCTAGGATTACAAATGTTACTCGAGTAACATTTGTAATCCTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108265    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_213656.2-1539s1c1
Sequence:CCGGCATTTATGAAACAGAGGCCAACTCGAGTTGGCCTCTGTTTCATAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-444s1c1
Sequence:CCGGCCCTGTTCTATGTCCTGATTACTCGAGTAATCAGGACATAGAACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213656.2-568s1c1
Sequence:CCGGGCAGATGACTTGAGAGCCAAACTCGAGTTTGGCTCTCAAGTCATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213730
KRT39 MISSION shRNA Bacterial Glycerol Stock
keratin 39
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-176s1c1
Sequence:CCGGGCCTTTATCGATGCCCTCATTCTCGAGAATGAGGGCATCGATAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-754s1c1
Sequence:CCGGCCTTCTGTTGACCTAAATCAACTCGAGTTGATTTAGGTCAACAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-977s1c1
Sequence:CCGGGAATGAGAGAGTCCCAGGAATCTCGAGATTCCTGGGACTCTCTCATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-302s1c1
Sequence:CCGGGCCTTGCAAACTATCTGGAAACTCGAGTTTCCAGATAGTTTGCAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-255s1c1
Sequence:CCGGAGGCATTAACACTCATGAGAACTCGAGTTCTCATGAGTGTTAATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213730
KRT39 MISSION shRNA shRNA Plasmid DNA
keratin 39
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-176s1c1
Sequence:CCGGGCCTTTATCGATGCCCTCATTCTCGAGAATGAGGGCATCGATAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-754s1c1
Sequence:CCGGCCTTCTGTTGACCTAAATCAACTCGAGTTGATTTAGGTCAACAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-977s1c1
Sequence:CCGGGAATGAGAGAGTCCCAGGAATCTCGAGATTCCTGGGACTCTCTCATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-302s1c1
Sequence:CCGGGCCTTGCAAACTATCTGGAAACTCGAGTTTCCAGATAGTTTGCAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-255s1c1
Sequence:CCGGAGGCATTAACACTCATGAGAACTCGAGTTCTCATGAGTGTTAATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213730
KRT39 MISSION shRNA Lentiviral Transduction Particles
keratin 39
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-176s1c1
Sequence:CCGGGCCTTTATCGATGCCCTCATTCTCGAGAATGAGGGCATCGATAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-754s1c1
Sequence:CCGGCCTTCTGTTGACCTAAATCAACTCGAGTTGATTTAGGTCAACAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-977s1c1
Sequence:CCGGGAATGAGAGAGTCCCAGGAATCTCGAGATTCCTGGGACTCTCTCATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-302s1c1
Sequence:CCGGGCCTTGCAAACTATCTGGAAACTCGAGTTTCCAGATAGTTTGCAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213730.1-255s1c1
Sequence:CCGGAGGCATTAACACTCATGAGAACTCGAGTTCTCATGAGTGTTAATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)