EMAIL THIS PAGE TO A FRIEND

KRT3

keratin 3

37 Gene Product Result for
Synonyms: CK3 K3
UniProtKB ID: P12035, A6NIS2, Q701L8
Gene ID:
Human(3850) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the corneal epithelium with family member KRT12 and mutations in these genes have been associated with Meesmann's Corneal Dystrophy. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
chicken(769040) keratin 3
cow(281267) keratin 3
cow(407188) keratin 3
dog(486519) keratin 3
sheep(101111010) keratin 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057088 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057088 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183715 predicted 1031
2 SASI_Hs01_00183716 predicted 1075
3 SASI_Hs01_00183717 predicted 1027
4 SASI_Hs01_00183719 predicted 983
5 SASI_Hs01_00183720 predicted 989
6 SASI_Hs01_00183721 predicted 1043
7 SASI_Hs01_00183722 predicted 1346
8 SASI_Hs01_00183723 predicted 1298
9 SASI_Hs01_00183724 predicted 990
10 SASI_Hs02_00361998 predicted 880
11 SASI_Hs01_00183718 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057088
KRT3 MISSION shRNA Bacterial Glycerol Stock
keratin 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-731s1c1
Sequence:CCGGCAAACAACCTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGGTTGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057088.1-2055s1c1
Sequence:CCGGTCACGAGAATTTCAGGCTCTTCTCGAGAAGAGCCTGAAATTCTCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-996s1c1
Sequence:CCGGCGACTTCTTAAGGACCCTCTACTCGAGTAGAGGGTCCTTAAGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1710s1c1
Sequence:CCGGCGGTGGAATCGGCGGTGGATTCTCGAGAATCCACCGCCGATTCCACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1230s1c1
Sequence:CCGGCCTAAGAAATACCAAGAGCGACTCGAGTCGCTCTTGGTATTTCTTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1935s21c1
Sequence:CCGGCCAGCGCTACTCCAGATAAAGCTCGAGCTTTATCTGGAGTAGCGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1181s21c1
Sequence:CCGGCTGAAGTTCGTGCACAGTATGCTCGAGCATACTGTGCACGAACTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057088
KRT3 MISSION shRNA shRNA Plasmid DNA
keratin 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-731s1c1
Sequence:CCGGCAAACAACCTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGGTTGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057088.1-2055s1c1
Sequence:CCGGTCACGAGAATTTCAGGCTCTTCTCGAGAAGAGCCTGAAATTCTCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-996s1c1
Sequence:CCGGCGACTTCTTAAGGACCCTCTACTCGAGTAGAGGGTCCTTAAGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1710s1c1
Sequence:CCGGCGGTGGAATCGGCGGTGGATTCTCGAGAATCCACCGCCGATTCCACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1230s1c1
Sequence:CCGGCCTAAGAAATACCAAGAGCGACTCGAGTCGCTCTTGGTATTTCTTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1935s21c1
Sequence:CCGGCCAGCGCTACTCCAGATAAAGCTCGAGCTTTATCTGGAGTAGCGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1181s21c1
Sequence:CCGGCTGAAGTTCGTGCACAGTATGCTCGAGCATACTGTGCACGAACTTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057088
KRT3 MISSION shRNA Lentiviral Transduction Particles
keratin 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-731s1c1
Sequence:CCGGCAAACAACCTTGAGCCTCTTTCTCGAGAAAGAGGCTCAAGGTTGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083913    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_057088.1-2055s1c1
Sequence:CCGGTCACGAGAATTTCAGGCTCTTCTCGAGAAGAGCCTGAAATTCTCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-996s1c1
Sequence:CCGGCGACTTCTTAAGGACCCTCTACTCGAGTAGAGGGTCCTTAAGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1710s1c1
Sequence:CCGGCGGTGGAATCGGCGGTGGATTCTCGAGAATCCACCGCCGATTCCACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057088.1-1230s1c1
Sequence:CCGGCCTAAGAAATACCAAGAGCGACTCGAGTCGCTCTTGGTATTTCTTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1935s21c1
Sequence:CCGGCCAGCGCTACTCCAGATAAAGCTCGAGCTTTATCTGGAGTAGCGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057088.2-1181s21c1
Sequence:CCGGCTGAAGTTCGTGCACAGTATGCTCGAGCATACTGTGCACGAACTTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)