EMAIL THIS PAGE TO A FRIEND

KRT40

keratin 40

81 Gene Product Result for
Synonyms: CK-40 K40 KA36
UniProtKB ID: Q6A162, Q6IFU5
Gene ID:
Human(125115) Summary: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
Mouse(406221) keratin 40
Rat(287679) keratin 40
dog(608072) keratin 40
cow(538611) keratin 40
Horse(100067378) keratin 40
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182497 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182497 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182497 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484076 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484076 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484076 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182497 Rosetta Predictions human pricing
NM_001008821 Rosetta Predictions rat pricing
XM_579218 Rosetta Predictions rat pricing
NM_001039666 Rosetta Predictions mouse pricing
XM_979758 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370538 predicted 866
2 SASI_Hs02_00370539 predicted 824
3 SASI_Hs01_00045110 predicted 503
4 SASI_Hs01_00045115 predicted 387
5 SASI_Hs02_00370540 predicted 1389
6 SASI_Hs01_00045117 predicted 427
7 SASI_Hs02_00370541 predicted 1287
8 SASI_Hs02_00370542 predicted 636
9 SASI_Hs02_00370543 predicted 592
10 SASI_Hs02_00370544 predicted 1319
11 SASI_Hs01_00045109 predicted 815
12 SASI_Hs01_00045111 predicted 583
13 SASI_Hs01_00045112 predicted 982
14 SASI_Hs01_00045113 predicted 948
15 SASI_Hs01_00045114 predicted 962
16 SASI_Hs01_00045116 predicted 587
17 SASI_Hs01_00045118 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008821 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054565 predicted 396
2 SASI_Rn01_00054566 predicted 522
3 SASI_Rn01_00054567 predicted 768
4 SASI_Rn01_00054568 predicted 424
5 SASI_Rn01_00054570 predicted 490
6 SASI_Rn01_00054571 predicted 650
7 SASI_Rn01_00054572 predicted 1033
8 SASI_Rn01_00054573 predicted 405
9 SASI_Rn01_00054574 predicted 218
10 SASI_Rn02_00199312 predicted 993
11 SASI_Rn01_00054569 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579218 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152773 predicted 399
2 SASI_Rn01_00152774 predicted 523
3 SASI_Rn01_00152775 predicted 777
4 SASI_Rn01_00152776 predicted 426
5 SASI_Rn01_00152777 predicted 989
6 SASI_Rn01_00152778 predicted 494
7 SASI_Rn01_00152779 predicted 652
8 SASI_Rn01_00152780 predicted 1039
9 SASI_Rn01_00152781 predicted 412
10 SASI_Rn01_00152782 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039666 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144709 predicted 518
2 SASI_Mm01_00144710 predicted 774
3 SASI_Mm01_00144711 predicted 898
4 SASI_Mm01_00144712 predicted 651
5 SASI_Mm01_00144713 predicted 1030
6 SASI_Mm01_00144714 predicted 417
7 SASI_Mm01_00144715 predicted 462
8 SASI_Mm01_00144717 predicted 420
9 SASI_Mm01_00144718 predicted 241
10 SASI_Mm02_00290193 predicted 242
11 SASI_Mm01_00144716 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_979758 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221151 predicted 240
2 SASI_Mm01_00221152 predicted 232
3 SASI_Mm01_00221153 predicted 242
4 SASI_Mm01_00221154 predicted 249
5 SASI_Mm01_00221155 predicted 246
6 SASI_Mm01_00221156 predicted 245
7 SASI_Mm01_00221157 predicted 234
8 SASI_Mm01_00221158 predicted 241
9 SASI_Mm01_00221159 predicted 236
10 SASI_Mm01_00221160 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182497
KRT40 MISSION shRNA Bacterial Glycerol Stock
keratin 40
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000432770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-941s21c1
Sequence:CCGGGATGCGCTGTCAGTGTGAAACCTCGAGGTTTCACACTGACAGCGCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-349s21c1
Sequence:CCGGACTTTACTGGGAGTTGTAATACTCGAGTATTACAACTCCCAGTAAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182497.1-1876s1c1
Sequence:CCGGGCATGGTAAATATAGCTCTATCTCGAGATAGAGCTATATTTACCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182497.3-1711s21c1
Sequence:CCGGATATAGCTCTATGGCTGATTACTCGAGTAATCAGCCATAGAGCTATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-561s1c1
Sequence:CCGGCCCGGATTATCAGCGTTACTTCTCGAGAAGTAACGCTGATAATCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-574s1c1
Sequence:CCGGCGTTACTTCAACACCATTGAACTCGAGTTCAATGGTGTTGAAGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-671s1c1
Sequence:CCGGCCACTGATGACTTTAAGTCAACTCGAGTTGACTTAAAGTCATCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-571s1c1
Sequence:CCGGCAGCGTTACTTCAACACCATTCTCGAGAATGGTGTTGAAGTAACGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182497
KRT40 MISSION shRNA shRNA Plasmid DNA
keratin 40
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000432770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-941s21c1
Sequence:CCGGGATGCGCTGTCAGTGTGAAACCTCGAGGTTTCACACTGACAGCGCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-349s21c1
Sequence:CCGGACTTTACTGGGAGTTGTAATACTCGAGTATTACAACTCCCAGTAAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182497.1-1876s1c1
Sequence:CCGGGCATGGTAAATATAGCTCTATCTCGAGATAGAGCTATATTTACCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182497.3-1711s21c1
Sequence:CCGGATATAGCTCTATGGCTGATTACTCGAGTAATCAGCCATAGAGCTATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-561s1c1
Sequence:CCGGCCCGGATTATCAGCGTTACTTCTCGAGAAGTAACGCTGATAATCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-574s1c1
Sequence:CCGGCGTTACTTCAACACCATTGAACTCGAGTTCAATGGTGTTGAAGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-671s1c1
Sequence:CCGGCCACTGATGACTTTAAGTCAACTCGAGTTGACTTAAAGTCATCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-571s1c1
Sequence:CCGGCAGCGTTACTTCAACACCATTCTCGAGAATGGTGTTGAAGTAACGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182497
KRT40 MISSION shRNA Lentiviral Transduction Particles
keratin 40
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000432770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-941s21c1
Sequence:CCGGGATGCGCTGTCAGTGTGAAACCTCGAGGTTTCACACTGACAGCGCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182497.3-349s21c1
Sequence:CCGGACTTTACTGGGAGTTGTAATACTCGAGTATTACAACTCCCAGTAAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116542    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182497.1-1876s1c1
Sequence:CCGGGCATGGTAAATATAGCTCTATCTCGAGATAGAGCTATATTTACCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422933    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182497.3-1711s21c1
Sequence:CCGGATATAGCTCTATGGCTGATTACTCGAGTAATCAGCCATAGAGCTATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-561s1c1
Sequence:CCGGCCCGGATTATCAGCGTTACTTCTCGAGAAGTAACGCTGATAATCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-574s1c1
Sequence:CCGGCGTTACTTCAACACCATTGAACTCGAGTTCAATGGTGTTGAAGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-671s1c1
Sequence:CCGGCCACTGATGACTTTAAGTCAACTCGAGTTGACTTAAAGTCATCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182497.1-571s1c1
Sequence:CCGGCAGCGTTACTTCAACACCATTCTCGAGAATGGTGTTGAAGTAACGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484076
KRT40 MISSION shRNA Bacterial Glycerol Stock
keratin 40
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-484s1c1
Sequence:CCGGGTTCAGGTGGACAACTGCAAACTCGAGTTTGCAGTTGTCCACCTGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-412s1c1
Sequence:CCGGCGGTACTTCGACACCATTGAACTCGAGTTCAATGGTGTCGAAGTACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-772s1c1
Sequence:CCGGCTGGATGAGATGCGATGTCAACTCGAGTTGACATCGCATCTCATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-1041s1c1
Sequence:CCGGGCAGTGCCTAATTGACAGTGTCTCGAGACACTGTCAATTAGGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-364s1c1
Sequence:CCGGCGAGAGCAATGCGAGCCCAATCTCGAGATTGGGCTCGCATTGCTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484076
KRT40 MISSION shRNA shRNA Plasmid DNA
keratin 40
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-484s1c1
Sequence:CCGGGTTCAGGTGGACAACTGCAAACTCGAGTTTGCAGTTGTCCACCTGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-412s1c1
Sequence:CCGGCGGTACTTCGACACCATTGAACTCGAGTTCAATGGTGTCGAAGTACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-772s1c1
Sequence:CCGGCTGGATGAGATGCGATGTCAACTCGAGTTGACATCGCATCTCATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-1041s1c1
Sequence:CCGGGCAGTGCCTAATTGACAGTGTCTCGAGACACTGTCAATTAGGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-364s1c1
Sequence:CCGGCGAGAGCAATGCGAGCCCAATCTCGAGATTGGGCTCGCATTGCTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484076
KRT40 MISSION shRNA Lentiviral Transduction Particles
keratin 40
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-484s1c1
Sequence:CCGGGTTCAGGTGGACAACTGCAAACTCGAGTTTGCAGTTGTCCACCTGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-412s1c1
Sequence:CCGGCGGTACTTCGACACCATTGAACTCGAGTTCAATGGTGTCGAAGTACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-772s1c1
Sequence:CCGGCTGGATGAGATGCGATGTCAACTCGAGTTGACATCGCATCTCATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-1041s1c1
Sequence:CCGGGCAGTGCCTAATTGACAGTGTCTCGAGACACTGTCAATTAGGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484076.1-364s1c1
Sequence:CCGGCGAGAGCAATGCGAGCCCAATCTCGAGATTGGGCTCGCATTGCTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)