EMAIL THIS PAGE TO A FRIEND

Krt42

26 Gene Product Result for
Gene ID:
Rat(450231) keratin 42
dog(490976) keratin 42
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU200811 MISSION® esiRNA targeting mouse Krt42 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008816 Rosetta Predictions rat pricing
NM_212483 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008816 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095157 predicted 879
2 SASI_Rn01_00095159 predicted 551
3 SASI_Rn01_00095160 predicted 840
4 SASI_Rn01_00095161 predicted 1092
5 SASI_Rn01_00095162 predicted 478
6 SASI_Rn01_00095163 predicted 465
7 SASI_Rn01_00095164 predicted 1007
8 SASI_Rn01_00095165 predicted 1058
9 SASI_Rn01_00095166 predicted 1212
10 SASI_Rn02_00199309 predicted 79
11 SASI_Rn01_00095158 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212483 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076243 predicted 481
2 SASI_Mm01_00076246 predicted 1211
3 SASI_Mm01_00076248 predicted 1099
4 SASI_Mm01_00076249 predicted 1105
5 SASI_Mm02_00352279 predicted 1292
6 SASI_Mm01_00076250 predicted 550
7 SASI_Mm02_00352280 predicted 471
8 SASI_Mm02_00352281 predicted 368
9 SASI_Mm01_00076251 predicted 282
10 SASI_Mm02_00352282 predicted 890
11 SASI_Mm01_00076242 predicted 797
12 SASI_Mm01_00076244 predicted 867
13 SASI_Mm01_00076245 predicted 848
14 SASI_Mm01_00076247 predicted 841
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212483
Krt42 MISSION shRNA Bacterial Glycerol Stock
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-676s1c1
Sequence:CCGGGCCTATCTGAGGAAGAACCATCTCGAGATGGTTCTTCCTCAGATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212483.1-1371s1c1
Sequence:CCGGGCGTATGATAGCCCAGGCCCACTCGAGTGGGCCTGGGCTATCATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-135s1c1
Sequence:CCGGAGGTGGAAGCTGTGGCAATATCTCGAGATATTGCCACAGCTTCCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-1214s1c1
Sequence:CCGGTGGCTACTCAATACTCCTCATCTCGAGATGAGGAGTATTGAGTAGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-375s1c1
Sequence:CCGGGATCCGTGAGTGGTACAAGAACTCGAGTTCTTGTACCACTCACGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212483
Krt42 MISSION shRNA shRNA Plasmid DNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-676s1c1
Sequence:CCGGGCCTATCTGAGGAAGAACCATCTCGAGATGGTTCTTCCTCAGATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212483.1-1371s1c1
Sequence:CCGGGCGTATGATAGCCCAGGCCCACTCGAGTGGGCCTGGGCTATCATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-135s1c1
Sequence:CCGGAGGTGGAAGCTGTGGCAATATCTCGAGATATTGCCACAGCTTCCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-1214s1c1
Sequence:CCGGTGGCTACTCAATACTCCTCATCTCGAGATGAGGAGTATTGAGTAGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-375s1c1
Sequence:CCGGGATCCGTGAGTGGTACAAGAACTCGAGTTCTTGTACCACTCACGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212483
Krt42 MISSION shRNA Lentiviral Transduction Particles
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-676s1c1
Sequence:CCGGGCCTATCTGAGGAAGAACCATCTCGAGATGGTTCTTCCTCAGATAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212483.1-1371s1c1
Sequence:CCGGGCGTATGATAGCCCAGGCCCACTCGAGTGGGCCTGGGCTATCATACGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-135s1c1
Sequence:CCGGAGGTGGAAGCTGTGGCAATATCTCGAGATATTGCCACAGCTTCCACCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-1214s1c1
Sequence:CCGGTGGCTACTCAATACTCCTCATCTCGAGATGAGGAGTATTGAGTAGCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000091024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212483.1-375s1c1
Sequence:CCGGGATCCGTGAGTGGTACAAGAACTCGAGTTCTTGTACCACTCACGGATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???