EMAIL THIS PAGE TO A FRIEND

KRT4

keratin 4

134 Gene Product Result for
Synonyms: CK-4 CK4 CYK4 K4
UniProtKB ID: P19013, F8VS64, Q6GTR8, Q96LA7, Q9BTL1
Gene ID:
Human(3851) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(16682) keratin 4
Rat(315323) keratin 4
sheep(101108902) keratin 4
Zebrafish(794486) keratin 4
cow(527819) keratin 4
Horse(100061857) keratin 4
dog(100682832) keratin 4
chicken(768882) keratin 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB5500128 Anti-Keratin 4 antibody, Rabbit monoclonal clone SP210, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
immunohistochemistry pricing
HPA034881 Anti-KRT4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1410738 Anti-KRT4 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
C5176 Monoclonal Anti-Cytokeratin Peptide 4 antibody produced in mouse clone 6B10, ascites fluid goat, hamster, guinea pig, feline, sheep, human, rabbit, canine
immunofluorescence, immunohistochemistry, microarray, western blot pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
WH0003851M1 Monoclonal Anti-KRT4 antibody produced in mouse clone 5H5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008475 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008475 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008475 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002272 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002272 Rosetta Predictions human pricing
NM_001008806 Rosetta Predictions rat pricing
NM_008475 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333541 predicted 1050
2 SASI_Hs01_00010551 predicted 949
3 SASI_Hs01_00010553 predicted 806
4 SASI_Hs01_00010554 predicted 904
5 SASI_Hs01_00010555 predicted 1080
6 SASI_Hs02_00333542 predicted 1278
7 SASI_Hs01_00010557 predicted 1653
8 SASI_Hs01_00010558 predicted 951
9 SASI_Hs01_00010559 predicted 546
10 SASI_Hs02_00333543 predicted 484
11 SASI_Hs01_00010552 predicted 1132
12 SASI_Hs01_00010556 predicted 1811
13 SASI_Hs01_00010560 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008806 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00078213 predicted 631
2 SASI_Rn01_00078214 predicted 1199
3 SASI_Rn01_00078215 predicted 632
4 SASI_Rn01_00078216 predicted 972
5 SASI_Rn01_00078217 predicted 814
6 SASI_Rn01_00078218 predicted 1109
7 SASI_Rn01_00078219 predicted 574
8 SASI_Rn01_00078220 predicted 617
9 SASI_Rn02_00199297 predicted 877
10 SASI_Rn01_00078222 predicted 1052
11 SASI_Rn01_00078221 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008475 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064501 predicted 694
2 SASI_Mm01_00064502 predicted 229
3 SASI_Mm01_00064503 predicted 1140
4 SASI_Mm01_00064506 predicted 644
5 SASI_Mm01_00064507 predicted 871
6 SASI_Mm02_00313987 predicted 1102
7 SASI_Mm02_00313988 predicted 548
8 SASI_Mm01_00064508 predicted 686
9 SASI_Mm01_00064509 predicted 1681
10 SASI_Mm01_00064510 predicted 939
11 SASI_Mm01_00064504 predicted 200
12 SASI_Mm01_00064505 predicted 1124
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008475
KRT4 MISSION shRNA Bacterial Glycerol Stock
keratin 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008475.1-1883s1c1
Sequence:CCGGCTTCTTCTCAACTTGGGTCAACTCGAGTTGACCCAAGTTGAGAAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-1333s1c1
Sequence:CCGGGCCTACAGCAAACGCGCAGAACTCGAGTTCTGCGCGTTTGCTGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-258s1c1
Sequence:CCGGCGGCAGCAGAAGTCTTTACAACTCGAGTTGTAAAGACTTCTGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-708s1c1
Sequence:CCGGTGAGACTTACATCAACGCCTTCTCGAGAAGGCGTTGATGTAAGTCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-765s1c1
Sequence:CCGGTCGCCTACAGTCAGAGCTAAACTCGAGTTTAGCTCTGACTGTAGGCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008475
KRT4 MISSION shRNA shRNA Plasmid DNA
keratin 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008475.1-1883s1c1
Sequence:CCGGCTTCTTCTCAACTTGGGTCAACTCGAGTTGACCCAAGTTGAGAAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-1333s1c1
Sequence:CCGGGCCTACAGCAAACGCGCAGAACTCGAGTTCTGCGCGTTTGCTGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-258s1c1
Sequence:CCGGCGGCAGCAGAAGTCTTTACAACTCGAGTTGTAAAGACTTCTGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-708s1c1
Sequence:CCGGTGAGACTTACATCAACGCCTTCTCGAGAAGGCGTTGATGTAAGTCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-765s1c1
Sequence:CCGGTCGCCTACAGTCAGAGCTAAACTCGAGTTTAGCTCTGACTGTAGGCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008475
KRT4 MISSION shRNA Lentiviral Transduction Particles
keratin 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090923    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008475.1-1883s1c1
Sequence:CCGGCTTCTTCTCAACTTGGGTCAACTCGAGTTGACCCAAGTTGAGAAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-1333s1c1
Sequence:CCGGGCCTACAGCAAACGCGCAGAACTCGAGTTCTGCGCGTTTGCTGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-258s1c1
Sequence:CCGGCGGCAGCAGAAGTCTTTACAACTCGAGTTGTAAAGACTTCTGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-708s1c1
Sequence:CCGGTGAGACTTACATCAACGCCTTCTCGAGAAGGCGTTGATGTAAGTCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008475.1-765s1c1
Sequence:CCGGTCGCCTACAGTCAGAGCTAAACTCGAGTTTAGCTCTGACTGTAGGCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002272
KRT4 MISSION shRNA Bacterial Glycerol Stock
keratin 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1000s1c1
Sequence:CCGGGCAGTTCTTAGAGCAACAGAACTCGAGTTCTGTTGCTCTAAGAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1129s1c1
Sequence:CCGGGCTAGATACCTTGGGCAATGACTCGAGTCATTGCCCAAGGTATCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002272.1-2387s1c1
Sequence:CCGGGAGTGTCATCTCCAGAATTATCTCGAGATAATTCTGGAGATGACACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1700s1c1
Sequence:CCGGCGAGGTGAGAATGCCCTTAAACTCGAGTTTAAGGGCATTCTCACCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1127s1c1
Sequence:CCGGCAGCTAGATACCTTGGGCAATCTCGAGATTGCCCAAGGTATCTAGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002272.2-1507s21c1
Sequence:CCGGGATCTCGGTTGACCAACATGGCTCGAGCCATGTTGGTCAACCGAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002272
KRT4 MISSION shRNA shRNA Plasmid DNA
keratin 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1000s1c1
Sequence:CCGGGCAGTTCTTAGAGCAACAGAACTCGAGTTCTGTTGCTCTAAGAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1129s1c1
Sequence:CCGGGCTAGATACCTTGGGCAATGACTCGAGTCATTGCCCAAGGTATCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002272.1-2387s1c1
Sequence:CCGGGAGTGTCATCTCCAGAATTATCTCGAGATAATTCTGGAGATGACACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1700s1c1
Sequence:CCGGCGAGGTGAGAATGCCCTTAAACTCGAGTTTAAGGGCATTCTCACCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1127s1c1
Sequence:CCGGCAGCTAGATACCTTGGGCAATCTCGAGATTGCCCAAGGTATCTAGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002272.2-1507s21c1
Sequence:CCGGGATCTCGGTTGACCAACATGGCTCGAGCCATGTTGGTCAACCGAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002272
KRT4 MISSION shRNA Lentiviral Transduction Particles
keratin 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1000s1c1
Sequence:CCGGGCAGTTCTTAGAGCAACAGAACTCGAGTTCTGTTGCTCTAAGAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1129s1c1
Sequence:CCGGGCTAGATACCTTGGGCAATGACTCGAGTCATTGCCCAAGGTATCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083823    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002272.1-2387s1c1
Sequence:CCGGGAGTGTCATCTCCAGAATTATCTCGAGATAATTCTGGAGATGACACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1700s1c1
Sequence:CCGGCGAGGTGAGAATGCCCTTAAACTCGAGTTTAAGGGCATTCTCACCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002272.1-1127s1c1
Sequence:CCGGCAGCTAGATACCTTGGGCAATCTCGAGATTGCCCAAGGTATCTAGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002272.2-1507s21c1
Sequence:CCGGGATCTCGGTTGACCAACATGGCTCGAGCCATGTTGGTCAACCGAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)