EMAIL THIS PAGE TO A FRIEND

KRT5

keratin 5

93 Gene Product Result for
Synonyms: CK5 DDD DDD1 EBS2 K5 KRT5A
UniProtKB ID: P13647, Q6PI71, Q6UBJ0, Q8TA91
Gene ID:
Human(3852) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the basal layer of the epidermis with family member KRT14. Mutations in these genes have been associated with a complex of diseases termed epidermolysis bullosa simplex. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(110308) keratin 5
Rat(369017) keratin 5
Zebrafish(797351) keratin 5
chicken(407779) keratin 5
cow(281268) keratin 5
Horse(100061626) keratin 5
dog(100687760) keratin 5
sheep(100303605) keratin 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501651 Anti-Keratin 5 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB5500129 Anti-Keratin 5 antibody, Rabbit monoclonal clone SP178, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB5500130 Anti-Keratin 5 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP27, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
HPA059479 Anti-KRT5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry pricing
SAB1410739 Anti-KRT5 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5300264 Monoclonal Anti-Cytokeratin (Pan) antibody produced in mouse clone 7H8C4, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300266 Monoclonal Anti-Cytokeratin (Pan) antibody produced in mouse clone 7H8, ascites fluid human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300265 Monoclonal Anti-Cytokeratin 5 antibody produced in mouse clone 1E1, ascites fluid human
ELISA, western blot pricing
SAB5300267 Monoclonal Anti-Cytokeratin 5 antibody produced in mouse clone 2C2, purified immunoglobulin, buffered aqueous solution human, monkey, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse ascites fluid, clone PCK-26 lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
SAB4100508 Monoclonal Anti-KRT5 antibody produced in mouse clone KRT5-A541, culture supernatant human
western blot pricing
SAB1402245 Monoclonal Anti-KRT5 antibody produced in mouse clone 1A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunoprecipitation (IP), western blot pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027011 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027011 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027011 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU016541 MISSION® esiRNA esiRNA targeting mouse Krt5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000424 Rosetta Predictions human pricing
NM_183333 Rosetta Predictions rat pricing
NM_027011 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201512 predicted 1033
2 SASI_Hs01_00201513 predicted 1045
3 SASI_Hs01_00201514 predicted 2035
4 SASI_Hs01_00201516 predicted 1038
5 SASI_Hs01_00201519 predicted 1054
6 SASI_Hs01_00201520 predicted 1996
7 SASI_Hs02_00302525 predicted 1304
8 SASI_Hs02_00302526 predicted 1620
9 SASI_Hs02_00302527 predicted 1619
10 SASI_Hs02_00302528 predicted 1924
11 SASI_Hs01_00201511 predicted 1388
12 SASI_Hs01_00201515 predicted 1304
13 SASI_Hs01_00201517 predicted 958
14 SASI_Hs01_00201518 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00076599 predicted 1710
2 SASI_Rn01_00076600 predicted 1660
3 SASI_Rn01_00076601 predicted 1465
4 SASI_Rn01_00076602 predicted 626
5 SASI_Rn01_00076603 predicted 448
6 SASI_Rn01_00076604 predicted 1058
7 SASI_Rn01_00076605 predicted 617
8 SASI_Rn01_00076606 predicted 1002
9 SASI_Rn01_00076607 predicted 1077
10 SASI_Rn01_00076608 predicted 1383
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027011 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331393 predicted 1522
2 SASI_Mm01_00052903 predicted 1330
3 SASI_Mm02_00331394 predicted 1520
4 SASI_Mm01_00052906 predicted 955
5 SASI_Mm01_00052907 predicted 864
6 SASI_Mm01_00052908 predicted 1252
7 SASI_Mm02_00331395 predicted 1535
8 SASI_Mm01_00052909 predicted 708
9 SASI_Mm01_00052911 predicted 1329
10 SASI_Mm02_00331396 predicted 712
11 SASI_Mm01_00052902 predicted 1524
12 SASI_Mm01_00052904 predicted 1531
13 SASI_Mm01_00052905 predicted 1541
14 SASI_Mm01_00052910 predicted 1531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000424
KRT5 MISSION shRNA Bacterial Glycerol Stock
keratin 5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1615s21c1
Sequence:CCAGAGGAGTTGGACCAGTCAACATCTCGAGATGTTGACTGGTCCAACTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1357s1c1
Sequence:CCGGCGAGATTGACAATGTCAAGAACTCGAGTTCTTGACATTGTCAATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1741s1c1
Sequence:CCGGAGGTAGCAGTGGAAGCTACTACTCGAGTAGTAGCTTCCACTGCTACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-323s1c1
Sequence:CCGGGCTTGTGGAGTGGGTGGCTATCTCGAGATAGCCACCCACTCCACAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1318s1c1
Sequence:CCGGGATCACAGAGATGAACCGGATCTCGAGATCCGGTTCATCTCTGTGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000424.2-2119s1c1
Sequence:CCGGCCGCAGTTCTATATTCTGCTTCTCGAGAAGCAGAATATAGAACTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1054s21c1
Sequence:CCGGGGATGAGATTAACTTCATGAACTCGAGTTCATGAAGTTAATCTCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1311s21c1
Sequence:CCGGAGCATGAGATCTCTGAGATGACTCGAGTCATCTCAGAGATCTCATGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000424
KRT5 MISSION shRNA shRNA Plasmid DNA
keratin 5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1615s21c1
Sequence:CCAGAGGAGTTGGACCAGTCAACATCTCGAGATGTTGACTGGTCCAACTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1357s1c1
Sequence:CCGGCGAGATTGACAATGTCAAGAACTCGAGTTCTTGACATTGTCAATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1741s1c1
Sequence:CCGGAGGTAGCAGTGGAAGCTACTACTCGAGTAGTAGCTTCCACTGCTACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-323s1c1
Sequence:CCGGGCTTGTGGAGTGGGTGGCTATCTCGAGATAGCCACCCACTCCACAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1318s1c1
Sequence:CCGGGATCACAGAGATGAACCGGATCTCGAGATCCGGTTCATCTCTGTGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000083878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000424.2-2119s1c1
Sequence:CCGGCCGCAGTTCTATATTCTGCTTCTCGAGAAGCAGAATATAGAACTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1054s21c1
Sequence:CCGGGGATGAGATTAACTTCATGAACTCGAGTTCATGAAGTTAATCTCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1311s21c1
Sequence:CCGGAGCATGAGATCTCTGAGATGACTCGAGTCATCTCAGAGATCTCATGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000424
KRT5 MISSION shRNA Lentiviral Transduction Particles
keratin 5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1615s21c1
Sequence:CCAGAGGAGTTGGACCAGTCAACATCTCGAGATGTTGACTGGTCCAACTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1357s1c1
Sequence:CCGGCGAGATTGACAATGTCAAGAACTCGAGTTCTTGACATTGTCAATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1741s1c1
Sequence:CCGGAGGTAGCAGTGGAAGCTACTACTCGAGTAGTAGCTTCCACTGCTACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-323s1c1
Sequence:CCGGGCTTGTGGAGTGGGTGGCTATCTCGAGATAGCCACCCACTCCACAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000424.2-1318s1c1
Sequence:CCGGGATCACAGAGATGAACCGGATCTCGAGATCCGGTTCATCTCTGTGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000083878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000424.2-2119s1c1
Sequence:CCGGCCGCAGTTCTATATTCTGCTTCTCGAGAAGCAGAATATAGAACTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1054s21c1
Sequence:CCGGGGATGAGATTAACTTCATGAACTCGAGTTCATGAAGTTAATCTCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000424.3-1311s21c1
Sequence:CCGGAGCATGAGATCTCTGAGATGACTCGAGTCATCTCAGAGATCTCATGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027011
KRT5 MISSION shRNA Bacterial Glycerol Stock
keratin 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027011.1-2008s1c1
Sequence:CCGGGCTCAGTTCTACATTTGTGTTCTCGAGAACACAAATGTAGAACTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1285s1c1
Sequence:CCGGGCCAACCTCCAGAACGCCATTCTCGAGAATGGCGTTCTGGAGGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-711s1c1
Sequence:CCGGTCCGTTGTTTGAACAGTACATCTCGAGATGTACTGTTCAAACAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-712s1c1
Sequence:CCGGCCGTTGTTTGAACAGTACATTCTCGAGAATGTACTGTTCAAACAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1212s1c1
Sequence:CCGGGCACGAGATCTCTGAGATGAACTCGAGTTCATCTCAGAGATCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027011
KRT5 MISSION shRNA shRNA Plasmid DNA
keratin 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027011.1-2008s1c1
Sequence:CCGGGCTCAGTTCTACATTTGTGTTCTCGAGAACACAAATGTAGAACTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1285s1c1
Sequence:CCGGGCCAACCTCCAGAACGCCATTCTCGAGAATGGCGTTCTGGAGGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-711s1c1
Sequence:CCGGTCCGTTGTTTGAACAGTACATCTCGAGATGTACTGTTCAAACAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-712s1c1
Sequence:CCGGCCGTTGTTTGAACAGTACATTCTCGAGAATGTACTGTTCAAACAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1212s1c1
Sequence:CCGGGCACGAGATCTCTGAGATGAACTCGAGTTCATCTCAGAGATCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027011
KRT5 MISSION shRNA Lentiviral Transduction Particles
keratin 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089843    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027011.1-2008s1c1
Sequence:CCGGGCTCAGTTCTACATTTGTGTTCTCGAGAACACAAATGTAGAACTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1285s1c1
Sequence:CCGGGCCAACCTCCAGAACGCCATTCTCGAGAATGGCGTTCTGGAGGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-711s1c1
Sequence:CCGGTCCGTTGTTTGAACAGTACATCTCGAGATGTACTGTTCAAACAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-712s1c1
Sequence:CCGGCCGTTGTTTGAACAGTACATTCTCGAGAATGTACTGTTCAAACAACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027011.1-1212s1c1
Sequence:CCGGGCACGAGATCTCTGAGATGAACTCGAGTTCATCTCAGAGATCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)