EMAIL THIS PAGE TO A FRIEND

KRT6A

keratin 6A

40 Gene Product Result for
Synonyms: CK6A CK6C CK6D K6A K6C K6D KRT6C KRT6D
UniProtKB ID: P02538, A4QPC1, P48667, Q08AR4, Q6NT67, Q96CL4
Gene ID:
Human(3853) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. This KRT6 gene in particular encodes the most abundant isoform. Mutations in these genes have been associated with pachyonychia congenita. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(16687) keratin 6A
chicken(408041) keratin 6A
cow(614456) keratin 6A
dog(486523) keratin 6A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302696 ANTI-KRT6A (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2700299 Anti-KRT6A antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
HPA061168 Anti-KRT6A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA045697 Anti-KRT6A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300794 Anti-KRT6A antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse ascites fluid, clone PCK-26 lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008476 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008476 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008476 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005554 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005554 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005554 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005554 Rosetta Predictions human pricing
NM_008476 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005554 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054233 predicted 2133
2 SASI_Hs01_00054240 predicted 1892
3 SASI_Hs01_00054237 predicted 2116
4 SASI_Hs01_00054241 predicted 1891
5 SASI_Hs02_00339805 predicted 2136
6 SASI_Hs01_00054232 predicted 908
7 SASI_Hs01_00054234 predicted 912
8 SASI_Hs01_00054235 predicted 2023
9 SASI_Hs01_00054236 predicted 1470
10 SASI_Hs01_00054238 predicted 874
11 SASI_Hs01_00054239 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065819 predicted 902
2 SASI_Mm01_00065821 predicted 892
3 SASI_Mm01_00065822 predicted 1710
4 SASI_Mm01_00065827 predicted 909
5 SASI_Mm01_00065828 predicted 1726
6 SASI_Mm01_00065820 predicted 663
7 SASI_Mm01_00065823 predicted 954
8 SASI_Mm01_00065824 predicted 1538
9 SASI_Mm01_00065825 predicted 660
10 SASI_Mm01_00065826 predicted 1194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008476
KRT6A MISSION shRNA Bacterial Glycerol Stock
keratin 6A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008476.3-1911s1c1
Sequence:CCGGCCTGTGAGCTTACATCACAATCTCGAGATTGTGATGTAAGCTCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-909s1c1
Sequence:CCGGCAACTTCTTGAGAGCTCTCTACTCGAGTAGAGAGCTCTCAAGAAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-1656s1c1
Sequence:CCGGCCTCAGCTCTTCTACCATCAACTCGAGTTGATGGTAGAAGAGCTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-853s1c1
Sequence:CCGGGCCTACATGAACAAAGTTGAACTCGAGTTCAACTTTGTTCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-886s1c1
Sequence:CCGGGCAGACAGTCTAACAGATGATCTCGAGATCATCTGTTAGACTGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008476
KRT6A MISSION shRNA shRNA Plasmid DNA
keratin 6A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008476.3-1911s1c1
Sequence:CCGGCCTGTGAGCTTACATCACAATCTCGAGATTGTGATGTAAGCTCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-909s1c1
Sequence:CCGGCAACTTCTTGAGAGCTCTCTACTCGAGTAGAGAGCTCTCAAGAAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-1656s1c1
Sequence:CCGGCCTCAGCTCTTCTACCATCAACTCGAGTTGATGGTAGAAGAGCTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-853s1c1
Sequence:CCGGGCCTACATGAACAAAGTTGAACTCGAGTTCAACTTTGTTCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-886s1c1
Sequence:CCGGGCAGACAGTCTAACAGATGATCTCGAGATCATCTGTTAGACTGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008476
KRT6A MISSION shRNA Lentiviral Transduction Particles
keratin 6A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089683    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008476.3-1911s1c1
Sequence:CCGGCCTGTGAGCTTACATCACAATCTCGAGATTGTGATGTAAGCTCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-909s1c1
Sequence:CCGGCAACTTCTTGAGAGCTCTCTACTCGAGTAGAGAGCTCTCAAGAAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-1656s1c1
Sequence:CCGGCCTCAGCTCTTCTACCATCAACTCGAGTTGATGGTAGAAGAGCTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-853s1c1
Sequence:CCGGGCCTACATGAACAAAGTTGAACTCGAGTTCAACTTTGTTCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008476.3-886s1c1
Sequence:CCGGGCAGACAGTCTAACAGATGATCTCGAGATCATCTGTTAGACTGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005554
KRT6A MISSION shRNA Bacterial Glycerol Stock
keratin 6A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1050s1c1
Sequence:CCGGCGCTGAGGTCAAGGCCCAATACTCGAGTATTGGGCCTTGACCTCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005554.2-1931s1c1
Sequence:CCGGCCATCAGATCAACCTCTGATTCTCGAGAATCAGAGGTTGATCTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1392s1c1
Sequence:CCGGCCAGGAGCTGATGAATGTCAACTCGAGTTGACATTCATCAGCTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-787s1c1
Sequence:CCGGGAGGACTTCAAGAACAAATATCTCGAGATATTTGTTCTTGAAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-561s1c1
Sequence:CCGGCAACAAGTTTGCCTCCTTCATCTCGAGATGAAGGAGGCAAACTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005554
KRT6A MISSION shRNA shRNA Plasmid DNA
keratin 6A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1050s1c1
Sequence:CCGGCGCTGAGGTCAAGGCCCAATACTCGAGTATTGGGCCTTGACCTCAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005554.2-1931s1c1
Sequence:CCGGCCATCAGATCAACCTCTGATTCTCGAGAATCAGAGGTTGATCTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1392s1c1
Sequence:CCGGCCAGGAGCTGATGAATGTCAACTCGAGTTGACATTCATCAGCTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-787s1c1
Sequence:CCGGGAGGACTTCAAGAACAAATATCTCGAGATATTTGTTCTTGAAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-561s1c1
Sequence:CCGGCAACAAGTTTGCCTCCTTCATCTCGAGATGAAGGAGGCAAACTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005554
KRT6A MISSION shRNA Lentiviral Transduction Particles
keratin 6A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1050s1c1
Sequence:CCGGCGCTGAGGTCAAGGCCCAATACTCGAGTATTGGGCCTTGACCTCAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084028    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005554.2-1931s1c1
Sequence:CCGGCCATCAGATCAACCTCTGATTCTCGAGAATCAGAGGTTGATCTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-1392s1c1
Sequence:CCGGCCAGGAGCTGATGAATGTCAACTCGAGTTGACATTCATCAGCTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-787s1c1
Sequence:CCGGGAGGACTTCAAGAACAAATATCTCGAGATATTTGTTCTTGAAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005554.2-561s1c1
Sequence:CCGGCAACAAGTTTGCCTCCTTCATCTCGAGATGAAGGAGGCAAACTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)