EMAIL THIS PAGE TO A FRIEND

KRT6B

keratin 6B

44 Gene Product Result for
Synonyms: CK-6B CK6B K6B KRTL1 PC2
UniProtKB ID: P04259, P48669
Gene ID:
Human(3854) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. As many as six of this type II cytokeratin (KRT6) have been identified; the multiplicity of the genes is attributed to successive gene duplication events. The genes are expressed with family members KRT16 and/or KRT17 in the filiform papillae of the tongue, the stratified epithelial lining of oral mucosa and esophagus, the outer root sheath of hair follicles, and the glandular epithelia. Mutations in these genes have been associated with pachyonychia congenita. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. [provided by RefSeq, Jul 2008]
Mouse(16688) keratin 6B
dog(100687987) keratin 6B
cow(404115) keratin 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1409272 Anti-KRT6B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, ascites fluid lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
SAB1409267 Monoclonal Anti-KRT6B antibody produced in mouse clone 4G9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409268 Monoclonal Anti-KRT6B antibody produced in mouse clone 3C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409269 Monoclonal Anti-KRT6B antibody produced in mouse clone 3B6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409270 Monoclonal Anti-KRT6B antibody produced in mouse clone 1C4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409271 Monoclonal Anti-KRT6B antibody produced in mouse clone 1C12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005555 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005555 Rosetta Predictions human pricing
NM_010669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236411 predicted 1980
2 SASI_Hs01_00236412 predicted 1982
3 SASI_Hs02_00339806 predicted 1992
4 SASI_Hs01_00236414 predicted 1939
5 SASI_Hs01_00236416 predicted 1924
6 SASI_Hs01_00236419 predicted 1971
7 SASI_Hs02_00339807 predicted 1729
8 SASI_Hs02_00339808 predicted 1992
9 SASI_Hs01_00236413 predicted 866
10 SASI_Hs01_00236415 predicted 829
11 SASI_Hs01_00236417 predicted 1184
12 SASI_Hs01_00236418 predicted 631
13 SASI_Hs01_00236420 predicted 1213
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319098 predicted 1760
2 SASI_Mm02_00319099 predicted 86
3 SASI_Mm01_00180467 predicted 826
4 SASI_Mm01_00180468 predicted 889
5 SASI_Mm01_00180469 predicted 858
6 SASI_Mm01_00180470 predicted 630
7 SASI_Mm01_00180471 predicted 857
8 SASI_Mm01_00180472 predicted 870
9 SASI_Mm01_00180473 predicted 429
10 SASI_Mm01_00180474 predicted 920
11 SASI_Mm01_00180475 predicted 245
12 SASI_Mm01_00180476 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010669
KRT6B MISSION shRNA Bacterial Glycerol Stock
keratin 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-624s1c1
Sequence:CCGGGCCTATGTTTGAGCAGTACATCTCGAGATGTACTGCTCAAACATAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-1335s1c1
Sequence:CCGGCCAGGAACTCATGAATGTCAACTCGAGTTGACATTCATGAGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-886s1c1
Sequence:CCGGAGAGTTATTTATGAGGCAGAACTCGAGTTCTGCCTCATAAATAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-730s1c1
Sequence:CCGGGAGGACTACAAGAGCAAATATCTCGAGATATTTGCTCTTGTAGTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-820s1c1
Sequence:CCGGGCCTACATGACCAAGGTTGAACTCGAGTTCAACCTTGGTCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010669
KRT6B MISSION shRNA shRNA Plasmid DNA
keratin 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-624s1c1
Sequence:CCGGGCCTATGTTTGAGCAGTACATCTCGAGATGTACTGCTCAAACATAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-1335s1c1
Sequence:CCGGCCAGGAACTCATGAATGTCAACTCGAGTTGACATTCATGAGTTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-886s1c1
Sequence:CCGGAGAGTTATTTATGAGGCAGAACTCGAGTTCTGCCTCATAAATAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-730s1c1
Sequence:CCGGGAGGACTACAAGAGCAAATATCTCGAGATATTTGCTCTTGTAGTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-820s1c1
Sequence:CCGGGCCTACATGACCAAGGTTGAACTCGAGTTCAACCTTGGTCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010669
KRT6B MISSION shRNA Lentiviral Transduction Particles
keratin 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-624s1c1
Sequence:CCGGGCCTATGTTTGAGCAGTACATCTCGAGATGTACTGCTCAAACATAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-1335s1c1
Sequence:CCGGCCAGGAACTCATGAATGTCAACTCGAGTTGACATTCATGAGTTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-886s1c1
Sequence:CCGGAGAGTTATTTATGAGGCAGAACTCGAGTTCTGCCTCATAAATAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-730s1c1
Sequence:CCGGGAGGACTACAAGAGCAAATATCTCGAGATATTTGCTCTTGTAGTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010669.1-820s1c1
Sequence:CCGGGCCTACATGACCAAGGTTGAACTCGAGTTCAACCTTGGTCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005555
KRT6B MISSION shRNA Bacterial Glycerol Stock
keratin 6B
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-830s1c1
Sequence:CCGGGCCTACATGAACAAGGTTGAACTCGAGTTCAACCTTGTTCATGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-780s1c1
Sequence:CCGGGCACAGCAGCAGAGAATGAATCTCGAGATTCATTCTCTGCTGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-511s1c1
Sequence:CCGGCAACAACAAGTTTGCCTCCTTCTCGAGAAGGAGGCAAACTTGTTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005555.2-1951s1c1
Sequence:CCGGCTGCCATAATTCTGAGAAGAACTCGAGTTCTTCTCAGAATTATGGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-1135s1c1
Sequence:CCGGGCAGGAGATTGCTGAGATCAACTCGAGTTGATCTCAGCAATCTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005555.3-1613s21c1
Sequence:CCGGGCGTTGGAGGCGGCTTTAGTTCTCGAGAACTAAAGCCGCCTCCAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005555.3-2069s21c1
Sequence:CCGGGATGAGGAGTCCTCTCTTTAACTCGAGTTAAAGAGAGGACTCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005555
KRT6B MISSION shRNA shRNA Plasmid DNA
keratin 6B
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-830s1c1
Sequence:CCGGGCCTACATGAACAAGGTTGAACTCGAGTTCAACCTTGTTCATGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-780s1c1
Sequence:CCGGGCACAGCAGCAGAGAATGAATCTCGAGATTCATTCTCTGCTGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-511s1c1
Sequence:CCGGCAACAACAAGTTTGCCTCCTTCTCGAGAAGGAGGCAAACTTGTTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005555.2-1951s1c1
Sequence:CCGGCTGCCATAATTCTGAGAAGAACTCGAGTTCTTCTCAGAATTATGGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-1135s1c1
Sequence:CCGGGCAGGAGATTGCTGAGATCAACTCGAGTTGATCTCAGCAATCTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005555.3-1613s21c1
Sequence:CCGGGCGTTGGAGGCGGCTTTAGTTCTCGAGAACTAAAGCCGCCTCCAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005555.3-2069s21c1
Sequence:CCGGGATGAGGAGTCCTCTCTTTAACTCGAGTTAAAGAGAGGACTCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005555
KRT6B MISSION shRNA Lentiviral Transduction Particles
keratin 6B
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-830s1c1
Sequence:CCGGGCCTACATGAACAAGGTTGAACTCGAGTTCAACCTTGTTCATGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-780s1c1
Sequence:CCGGGCACAGCAGCAGAGAATGAATCTCGAGATTCATTCTCTGCTGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-511s1c1
Sequence:CCGGCAACAACAAGTTTGCCTCCTTCTCGAGAAGGAGGCAAACTTGTTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082888    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005555.2-1951s1c1
Sequence:CCGGCTGCCATAATTCTGAGAAGAACTCGAGTTCTTCTCAGAATTATGGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005555.2-1135s1c1
Sequence:CCGGGCAGGAGATTGCTGAGATCAACTCGAGTTGATCTCAGCAATCTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005555.3-1613s21c1
Sequence:CCGGGCGTTGGAGGCGGCTTTAGTTCTCGAGAACTAAAGCCGCCTCCAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005555.3-2069s21c1
Sequence:CCGGGATGAGGAGTCCTCTCTTTAACTCGAGTTAAAGAGAGGACTCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)