EMAIL THIS PAGE TO A FRIEND

KRT71

keratin 71

44 Gene Product Result for
Synonyms: K6IRS1 KRT6IRS KRT6IRS1
UniProtKB ID: Q3SY84, B3KVC1, Q3SY85, Q96DU2
Gene ID:
Human(112802) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Mouse(56735) keratin 71
Rat(683613) keratin 71
sheep(101112045) keratin 71
cow(532644) keratin 71
Horse(100061657) keratin 71
dog(486522) keratin 71
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019956 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019956 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019956 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033448 Rosetta Predictions human pricing
XM_001066742 Rosetta Predictions rat pricing
NM_019956 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150795 predicted 437
2 SASI_Hs01_00150796 predicted 1116
3 SASI_Hs01_00150798 predicted 840
4 SASI_Hs01_00150801 predicted 344
5 SASI_Hs01_00150802 predicted 1540
6 SASI_Hs01_00150803 predicted 1659
7 SASI_Hs02_00361337 predicted 1065
8 SASI_Hs02_00361338 predicted 1636
9 SASI_Hs02_00361339 predicted 835
10 SASI_Hs02_00361340 predicted 764
11 SASI_Hs01_00150797 predicted 1106
12 SASI_Hs01_00150799 predicted 1194
13 SASI_Hs01_00150800 predicted 744
14 SASI_Hs01_00150804 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001066742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00318602 predicted 793
2 SASI_Rn02_00318603 predicted 1133
3 SASI_Rn02_00318604 predicted 560
4 SASI_Rn02_00318605 predicted 1924
5 SASI_Rn02_00318606 predicted 1314
6 SASI_Rn02_00318607 predicted 1557
7 SASI_Rn02_00318608 predicted 1296
8 SASI_Rn02_00318609 predicted 1488
9 SASI_Rn02_00318610 predicted 1710
10 SASI_Rn02_00318611 predicted 1492
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019956 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00044008 predicted 353
2 SASI_Mm01_00044009 predicted 552
3 SASI_Mm01_00044010 predicted 1130
4 SASI_Mm01_00044011 predicted 1603
5 SASI_Mm01_00044012 predicted 789
6 SASI_Mm01_00044013 predicted 1311
7 SASI_Mm01_00044014 predicted 1479
8 SASI_Mm01_00044015 predicted 1528
9 SASI_Mm01_00044016 predicted 1485
10 SASI_Mm01_00044017 predicted 1559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033448
KRT71 MISSION shRNA Bacterial Glycerol Stock
keratin 71
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033448.2-998s21c1
Sequence:CCGGGAGATTGCCTTGAAGAGTAAGCTCGAGCTTACTCTTCAAGGCAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033448.2-2105s21c1
Sequence:CCGGACATCTAGCTCAGTCTCAAATCTCGAGATTTGAGACTGAGCTAGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1541s1c1
Sequence:CCGGGTGCCAACGATTACAAAGACACTCGAGTGTCTTTGTAATCGTTGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1119s1c1
Sequence:CCGGCTCAGAGATCGAGAACGTGAACTCGAGTTCACGTTCTCGATCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-772s1c1
Sequence:CCGGGCTTACGCCAATAAGGTGGAACTCGAGTTCCACCTTATTGGCGTAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-348s1c1
Sequence:CCGGCCACCAGGTTACCGTCAATGACTCGAGTCATTGACGGTAACCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033448.1-1980s1c1
Sequence:CCGGCCTAGCATAGTTCCTGCCTATCTCGAGATAGGCAGGAACTATGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033448
KRT71 MISSION shRNA shRNA Plasmid DNA
keratin 71
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033448.2-998s21c1
Sequence:CCGGGAGATTGCCTTGAAGAGTAAGCTCGAGCTTACTCTTCAAGGCAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033448.2-2105s21c1
Sequence:CCGGACATCTAGCTCAGTCTCAAATCTCGAGATTTGAGACTGAGCTAGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1541s1c1
Sequence:CCGGGTGCCAACGATTACAAAGACACTCGAGTGTCTTTGTAATCGTTGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1119s1c1
Sequence:CCGGCTCAGAGATCGAGAACGTGAACTCGAGTTCACGTTCTCGATCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-772s1c1
Sequence:CCGGGCTTACGCCAATAAGGTGGAACTCGAGTTCCACCTTATTGGCGTAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-348s1c1
Sequence:CCGGCCACCAGGTTACCGTCAATGACTCGAGTCATTGACGGTAACCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033448.1-1980s1c1
Sequence:CCGGCCTAGCATAGTTCCTGCCTATCTCGAGATAGGCAGGAACTATGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033448
KRT71 MISSION shRNA Lentiviral Transduction Particles
keratin 71
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033448.2-998s21c1
Sequence:CCGGGAGATTGCCTTGAAGAGTAAGCTCGAGCTTACTCTTCAAGGCAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033448.2-2105s21c1
Sequence:CCGGACATCTAGCTCAGTCTCAAATCTCGAGATTTGAGACTGAGCTAGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1541s1c1
Sequence:CCGGGTGCCAACGATTACAAAGACACTCGAGTGTCTTTGTAATCGTTGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-1119s1c1
Sequence:CCGGCTCAGAGATCGAGAACGTGAACTCGAGTTCACGTTCTCGATCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-772s1c1
Sequence:CCGGGCTTACGCCAATAAGGTGGAACTCGAGTTCCACCTTATTGGCGTAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033448.1-348s1c1
Sequence:CCGGCCACCAGGTTACCGTCAATGACTCGAGTCATTGACGGTAACCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033448.1-1980s1c1
Sequence:CCGGCCTAGCATAGTTCCTGCCTATCTCGAGATAGGCAGGAACTATGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019956
KRT71 MISSION shRNA Bacterial Glycerol Stock
keratin 71
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019956.1-1715s1c1
Sequence:CCGGCCTAGATGTGTCCTCAGCTAACTCGAGTTAGCTGAGGACACATCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1131s1c1
Sequence:CCGGCTCAGAGATTGAGAACGCAAACTCGAGTTTGCGTTCTCAATCTCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-294s1c1
Sequence:CCGGCGGAAGTATCTTTGGCAGTGTCTCGAGACACTGCCAAAGATACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1130s1c1
Sequence:CCGGGCTCAGAGATTGAGAACGCAACTCGAGTTGCGTTCTCAATCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-831s1c1
Sequence:CCGGCCAGGACATCAAATTCTTCAACTCGAGTTGAAGAATTTGATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019956
KRT71 MISSION shRNA shRNA Plasmid DNA
keratin 71
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019956.1-1715s1c1
Sequence:CCGGCCTAGATGTGTCCTCAGCTAACTCGAGTTAGCTGAGGACACATCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1131s1c1
Sequence:CCGGCTCAGAGATTGAGAACGCAAACTCGAGTTTGCGTTCTCAATCTCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-294s1c1
Sequence:CCGGCGGAAGTATCTTTGGCAGTGTCTCGAGACACTGCCAAAGATACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1130s1c1
Sequence:CCGGGCTCAGAGATTGAGAACGCAACTCGAGTTGCGTTCTCAATCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-831s1c1
Sequence:CCGGCCAGGACATCAAATTCTTCAACTCGAGTTGAAGAATTTGATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019956
KRT71 MISSION shRNA Lentiviral Transduction Particles
keratin 71
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090138    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019956.1-1715s1c1
Sequence:CCGGCCTAGATGTGTCCTCAGCTAACTCGAGTTAGCTGAGGACACATCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1131s1c1
Sequence:CCGGCTCAGAGATTGAGAACGCAAACTCGAGTTTGCGTTCTCAATCTCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-294s1c1
Sequence:CCGGCGGAAGTATCTTTGGCAGTGTCTCGAGACACTGCCAAAGATACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-1130s1c1
Sequence:CCGGGCTCAGAGATTGAGAACGCAACTCGAGTTGCGTTCTCAATCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019956.1-831s1c1
Sequence:CCGGCCAGGACATCAAATTCTTCAACTCGAGTTGAAGAATTTGATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)