EMAIL THIS PAGE TO A FRIEND

KRT72

keratin 72

45 Gene Product Result for
Synonyms: K6IRS2 K6irs KRT6 KRT6IRS2
UniProtKB ID: Q14CN4, B4DEI8, H9KV51, Q8NA87, Q8WWY9, Q8WWZ0
Gene ID:
Human(140807) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Mouse(105866) keratin 72
Rat(406227) keratin 72
cow(531057) keratin 72
dog(486520) keratin 72
sheep(101110219) keratin 72
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080747 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080747 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080747 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_213728 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213728 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213728 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU119881 MISSION® esiRNA esiRNA human KRT72 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080747 Rosetta Predictions human pricing
NM_001008809 Rosetta Predictions rat pricing
NM_213728 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080747 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186305 predicted 804
2 SASI_Hs01_00186306 predicted 1067
3 SASI_Hs01_00186307 predicted 430
4 SASI_Hs01_00186308 predicted 694
5 SASI_Hs01_00186309 predicted 767
6 SASI_Hs01_00186311 predicted 690
7 SASI_Hs01_00186312 predicted 1683
8 SASI_Hs01_00186313 predicted 1363
9 SASI_Hs01_00186314 predicted 1585
10 SASI_Hs02_00362546 predicted 813
11 SASI_Hs01_00186310 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008809 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00100973 predicted 1030
2 SASI_Rn01_00100974 predicted 960
3 SASI_Rn01_00100975 predicted 781
4 SASI_Rn01_00100976 predicted 1360
5 SASI_Rn01_00100977 predicted 773
6 SASI_Rn01_00100978 predicted 1087
7 SASI_Rn01_00100979 predicted 558
8 SASI_Rn01_00100980 predicted 1351
9 SASI_Rn01_00100981 predicted 656
10 SASI_Rn01_00100982 predicted 1417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213728 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037872 predicted 1067
2 SASI_Mm01_00037873 predicted 964
3 SASI_Mm02_00352303 predicted 1033
4 SASI_Mm01_00037874 predicted 1075
5 SASI_Mm01_00037875 predicted 778
6 SASI_Mm01_00037876 predicted 1032
7 SASI_Mm01_00037877 predicted 956
8 SASI_Mm01_00037878 predicted 1246
9 SASI_Mm01_00037879 predicted 1082
10 SASI_Mm01_00037880 predicted 1328
11 SASI_Mm01_00037881 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080747
KRT72 MISSION shRNA Bacterial Glycerol Stock
keratin 72
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-811s1c1
Sequence:CCGGCCTTGACAGATGAGATTAAATCTCGAGATTTAATCTCATCTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1117s1c1
Sequence:CCGGGCTCAGAGATAGGGAATGTGACTCGAGTCACATTCCCTATCTCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-809s1c1
Sequence:CCGGCTCCTTGACAGATGAGATTAACTCGAGTTAATCTCATCTGTCAAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1460s1c1
Sequence:CCGGCGCCTCAAGCAGTTATAGCTACTCGAGTAGCTATAACTGCTTGAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-789s21c1
Sequence:CCGGGACGTGGATGCTGCTTACATGCTCGAGCATGTAAGCAGCATCCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080747.2-1768s21c1
Sequence:CCGGGGTGTGATGCTTCGATGCAAGCTCGAGCTTGCATCGAAGCATCACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-726s21c1
Sequence:CCGGAGGTATGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCATACCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-475s21c1
Sequence:CCTGAGGCGCTAAACAACAAGTTCGCTCGAGCGAACTTGTTGTTTAGCGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-1398s21c1
Sequence:CCGGATGTCTGGCGAATATCCAAATCTCGAGATTTGGATATTCGCCAGACATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-702s21c1
Sequence:CCGGGATTTGGTGGAGGACTACAAGCTCGAGCTTGTAGTCCTCCACCAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080747
KRT72 MISSION shRNA shRNA Plasmid DNA
keratin 72
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-811s1c1
Sequence:CCGGCCTTGACAGATGAGATTAAATCTCGAGATTTAATCTCATCTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1117s1c1
Sequence:CCGGGCTCAGAGATAGGGAATGTGACTCGAGTCACATTCCCTATCTCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-809s1c1
Sequence:CCGGCTCCTTGACAGATGAGATTAACTCGAGTTAATCTCATCTGTCAAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1460s1c1
Sequence:CCGGCGCCTCAAGCAGTTATAGCTACTCGAGTAGCTATAACTGCTTGAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-789s21c1
Sequence:CCGGGACGTGGATGCTGCTTACATGCTCGAGCATGTAAGCAGCATCCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080747.2-1768s21c1
Sequence:CCGGGGTGTGATGCTTCGATGCAAGCTCGAGCTTGCATCGAAGCATCACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-726s21c1
Sequence:CCGGAGGTATGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCATACCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-475s21c1
Sequence:CCTGAGGCGCTAAACAACAAGTTCGCTCGAGCGAACTTGTTGTTTAGCGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-1398s21c1
Sequence:CCGGATGTCTGGCGAATATCCAAATCTCGAGATTTGGATATTCGCCAGACATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-702s21c1
Sequence:CCGGGATTTGGTGGAGGACTACAAGCTCGAGCTTGTAGTCCTCCACCAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080747
KRT72 MISSION shRNA Lentiviral Transduction Particles
keratin 72
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-811s1c1
Sequence:CCGGCCTTGACAGATGAGATTAAATCTCGAGATTTAATCTCATCTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1117s1c1
Sequence:CCGGGCTCAGAGATAGGGAATGTGACTCGAGTCACATTCCCTATCTCTGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-809s1c1
Sequence:CCGGCTCCTTGACAGATGAGATTAACTCGAGTTAATCTCATCTGTCAAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080747.1-1460s1c1
Sequence:CCGGCGCCTCAAGCAGTTATAGCTACTCGAGTAGCTATAACTGCTTGAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-789s21c1
Sequence:CCGGGACGTGGATGCTGCTTACATGCTCGAGCATGTAAGCAGCATCCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080747.2-1768s21c1
Sequence:CCGGGGTGTGATGCTTCGATGCAAGCTCGAGCTTGCATCGAAGCATCACACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-726s21c1
Sequence:CCGGAGGTATGAGGTGGAGATTAACCTCGAGGTTAATCTCCACCTCATACCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-475s21c1
Sequence:CCTGAGGCGCTAAACAACAAGTTCGCTCGAGCGAACTTGTTGTTTAGCGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-1398s21c1
Sequence:CCGGATGTCTGGCGAATATCCAAATCTCGAGATTTGGATATTCGCCAGACATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428998    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080747.2-702s21c1
Sequence:CCGGGATTTGGTGGAGGACTACAAGCTCGAGCTTGTAGTCCTCCACCAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213728
KRT72 MISSION shRNA Bacterial Glycerol Stock
keratin 72
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-782s1c1
Sequence:CCGGCCTTGACAGATGACATCAAATCTCGAGATTTGATGTCATCTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-546s1c1
Sequence:CCGGGCCTGTGCATGAGAGTTACATCTCGAGATGTAACTCTCATGCACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1372s1c1
Sequence:CCGGTCTGTCATTAGCAGTACCAATCTCGAGATTGGTACTGCTAATGACAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-325s1c1
Sequence:CCGGGTTGTCGTCAACAAGAGCCTTCTCGAGAAGGCTCTTGTTGACGACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1083s1c1
Sequence:CCGGGATCCATTCAGAGATAGGAAACTCGAGTTTCCTATCTCTGAATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213728
KRT72 MISSION shRNA shRNA Plasmid DNA
keratin 72
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-782s1c1
Sequence:CCGGCCTTGACAGATGACATCAAATCTCGAGATTTGATGTCATCTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-546s1c1
Sequence:CCGGGCCTGTGCATGAGAGTTACATCTCGAGATGTAACTCTCATGCACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1372s1c1
Sequence:CCGGTCTGTCATTAGCAGTACCAATCTCGAGATTGGTACTGCTAATGACAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-325s1c1
Sequence:CCGGGTTGTCGTCAACAAGAGCCTTCTCGAGAAGGCTCTTGTTGACGACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1083s1c1
Sequence:CCGGGATCCATTCAGAGATAGGAAACTCGAGTTTCCTATCTCTGAATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213728
KRT72 MISSION shRNA Lentiviral Transduction Particles
keratin 72
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-782s1c1
Sequence:CCGGCCTTGACAGATGACATCAAATCTCGAGATTTGATGTCATCTGTCAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-546s1c1
Sequence:CCGGGCCTGTGCATGAGAGTTACATCTCGAGATGTAACTCTCATGCACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1372s1c1
Sequence:CCGGTCTGTCATTAGCAGTACCAATCTCGAGATTGGTACTGCTAATGACAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-325s1c1
Sequence:CCGGGTTGTCGTCAACAAGAGCCTTCTCGAGAAGGCTCTTGTTGACGACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213728.1-1083s1c1
Sequence:CCGGGATCCATTCAGAGATAGGAAACTCGAGTTTCCTATCTCTGAATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)