EMAIL THIS PAGE TO A FRIEND

KRT73

keratin 73

57 Gene Product Result for
Synonyms: IRT6IRS3 K6IRS3 KRT6IRS3
UniProtKB ID: Q86Y46, Q32MB2
Gene ID:
Human(319101) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes a protein that is expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Mouse(223915) keratin 73
Rat(300248) keratin 73
sheep(101109951) keratin 73
cow(531981) keratin 73
Horse(100061725) keratin 73
dog(608027) keratin 73
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175068 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175068 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175068 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_212485 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212485 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212485 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175068 Rosetta Predictions human pricing
NM_001008808 Rosetta Predictions rat pricing
XM_001057910 Rosetta Predictions rat pricing
NM_212485 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175068 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116019 predicted 338
2 SASI_Hs02_00368976 predicted 692
3 SASI_Hs01_00116020 predicted 1618
4 SASI_Hs01_00116021 predicted 1612
5 SASI_Hs01_00116023 predicted 1715
6 SASI_Hs01_00116024 predicted 1608
7 SASI_Hs01_00116026 predicted 1722
8 SASI_Hs01_00116028 predicted 1370
9 SASI_Hs02_00368977 predicted 1655
10 SASI_Hs02_00368978 predicted 196
11 SASI_Hs01_00116022 predicted 1106
12 SASI_Hs01_00116025 predicted 889
13 SASI_Hs01_00116027 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008808 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091928 predicted 1363
2 SASI_Rn01_00091929 predicted 1091
3 SASI_Rn01_00091930 predicted 1081
4 SASI_Rn01_00091931 predicted 780
5 SASI_Rn01_00091933 predicted 538
6 SASI_Rn01_00091934 predicted 530
7 SASI_Rn01_00091935 predicted 779
8 SASI_Rn01_00091936 predicted 832
9 SASI_Rn02_00199300 predicted 782
10 SASI_Rn02_00199301 predicted 204
11 SASI_Rn01_00091927 predicted 554
12 SASI_Rn01_00091932 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00287943 predicted 992
2 SASI_Rn02_00287944 predicted 468
3 SASI_Rn02_00287945 predicted 397
4 SASI_Rn02_00287946 predicted 948
5 SASI_Rn02_00287947 predicted 686
6 SASI_Rn02_00287948 predicted 887
7 SASI_Rn02_00287949 predicted 703
8 SASI_Rn02_00287950 predicted 396
9 SASI_Rn02_00287951 predicted 699
10 SASI_Rn02_00287952 predicted 941
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212485 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095639 predicted 715
2 SASI_Mm02_00352284 predicted 675
3 SASI_Mm01_00095640 predicted 1596
4 SASI_Mm01_00095641 predicted 1108
5 SASI_Mm01_00095642 predicted 1648
6 SASI_Mm01_00095643 predicted 690
7 SASI_Mm01_00095645 predicted 1389
8 SASI_Mm01_00095646 predicted 236
9 SASI_Mm02_00352285 predicted 680
10 SASI_Mm01_00095647 predicted 303
11 SASI_Mm01_00095644 predicted 877
12 SASI_Mm01_00095648 predicted 704
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175068
KRT73 MISSION shRNA Bacterial Glycerol Stock
keratin 73
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-766s21c1
Sequence:CCGGACGCAGCTTACACGAGCAAAGCTCGAGCTTTGCTCGTGTAAGCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175068.2-2133s21c1
Sequence:CCGGTTGTATAGCCACTGCATATTACTCGAGTAATATGCAGTGGCTATACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-1610s21c1
Sequence:CCGGGGGAAAGACCTTAGCTCTAAGCTCGAGCTTAGAGCTAAGGTCTTTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175068.2-1807s1c1
Sequence:CCGGGCCTCAGTCTTTGTTAATGTTCTCGAGAACATTAACAAAGACTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1391s1c1
Sequence:CCGGCGTGAGCATTTCGGTCATCAACTCGAGTTGATGACCGAAATGCTCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1373s1c1
Sequence:CCGGCGGAGAATATACCAACTCCGTCTCGAGACGGAGTTGGTATATTCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-160s1c1
Sequence:CCGGGCTTCAGCAGTCGGAGCCTTTCTCGAGAAAGGCTCCGACTGCTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-195s1c1
Sequence:CCGGGCCCGGAGCATCTCTTTCAATCTCGAGATTGAAAGAGATGCTCCGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175068
KRT73 MISSION shRNA shRNA Plasmid DNA
keratin 73
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-766s21c1
Sequence:CCGGACGCAGCTTACACGAGCAAAGCTCGAGCTTTGCTCGTGTAAGCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175068.2-2133s21c1
Sequence:CCGGTTGTATAGCCACTGCATATTACTCGAGTAATATGCAGTGGCTATACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-1610s21c1
Sequence:CCGGGGGAAAGACCTTAGCTCTAAGCTCGAGCTTAGAGCTAAGGTCTTTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175068.2-1807s1c1
Sequence:CCGGGCCTCAGTCTTTGTTAATGTTCTCGAGAACATTAACAAAGACTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1391s1c1
Sequence:CCGGCGTGAGCATTTCGGTCATCAACTCGAGTTGATGACCGAAATGCTCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1373s1c1
Sequence:CCGGCGGAGAATATACCAACTCCGTCTCGAGACGGAGTTGGTATATTCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-160s1c1
Sequence:CCGGGCTTCAGCAGTCGGAGCCTTTCTCGAGAAAGGCTCCGACTGCTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-195s1c1
Sequence:CCGGGCCCGGAGCATCTCTTTCAATCTCGAGATTGAAAGAGATGCTCCGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175068
KRT73 MISSION shRNA Lentiviral Transduction Particles
keratin 73
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-766s21c1
Sequence:CCGGACGCAGCTTACACGAGCAAAGCTCGAGCTTTGCTCGTGTAAGCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175068.2-2133s21c1
Sequence:CCGGTTGTATAGCCACTGCATATTACTCGAGTAATATGCAGTGGCTATACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175068.2-1610s21c1
Sequence:CCGGGGGAAAGACCTTAGCTCTAAGCTCGAGCTTAGAGCTAAGGTCTTTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175068.2-1807s1c1
Sequence:CCGGGCCTCAGTCTTTGTTAATGTTCTCGAGAACATTAACAAAGACTGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1391s1c1
Sequence:CCGGCGTGAGCATTTCGGTCATCAACTCGAGTTGATGACCGAAATGCTCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-1373s1c1
Sequence:CCGGCGGAGAATATACCAACTCCGTCTCGAGACGGAGTTGGTATATTCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-160s1c1
Sequence:CCGGGCTTCAGCAGTCGGAGCCTTTCTCGAGAAAGGCTCCGACTGCTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175068.2-195s1c1
Sequence:CCGGGCCCGGAGCATCTCTTTCAATCTCGAGATTGAAAGAGATGCTCCGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212485
KRT73 MISSION shRNA Bacterial Glycerol Stock
keratin 73
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212485.1-2026s1c1
Sequence:CCGGGCACCGTTGTATCTGGCATAACTCGAGTTATGCCAGATACAACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-806s1c1
Sequence:CCGGCGCCCTGGATGGAGAGATCAACTCGAGTTGATCTCTCCATCCAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-199s1c1
Sequence:CCGGGCATCTCCTTCAATGTGGCTACTCGAGTAGCCACATTGAAGGAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-344s1c1
Sequence:CCGGCCACCAGGTAACAGTCAATAACTCGAGTTATTGACTGTTACCTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-1573s1c1
Sequence:CCGGGACTGGGTAGTGCAAGTGAATCTCGAGATTCACTTGCACTACCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212485
KRT73 MISSION shRNA shRNA Plasmid DNA
keratin 73
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212485.1-2026s1c1
Sequence:CCGGGCACCGTTGTATCTGGCATAACTCGAGTTATGCCAGATACAACGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-806s1c1
Sequence:CCGGCGCCCTGGATGGAGAGATCAACTCGAGTTGATCTCTCCATCCAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-199s1c1
Sequence:CCGGGCATCTCCTTCAATGTGGCTACTCGAGTAGCCACATTGAAGGAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-344s1c1
Sequence:CCGGCCACCAGGTAACAGTCAATAACTCGAGTTATTGACTGTTACCTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-1573s1c1
Sequence:CCGGGACTGGGTAGTGCAAGTGAATCTCGAGATTCACTTGCACTACCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212485
KRT73 MISSION shRNA Lentiviral Transduction Particles
keratin 73
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090478    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_212485.1-2026s1c1
Sequence:CCGGGCACCGTTGTATCTGGCATAACTCGAGTTATGCCAGATACAACGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-806s1c1
Sequence:CCGGCGCCCTGGATGGAGAGATCAACTCGAGTTGATCTCTCCATCCAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-199s1c1
Sequence:CCGGGCATCTCCTTCAATGTGGCTACTCGAGTAGCCACATTGAAGGAGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-344s1c1
Sequence:CCGGCCACCAGGTAACAGTCAATAACTCGAGTTATTGACTGTTACCTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212485.1-1573s1c1
Sequence:CCGGGACTGGGTAGTGCAAGTGAATCTCGAGATTCACTTGCACTACCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)