EMAIL THIS PAGE TO A FRIEND

KRT74

keratin 74

32 Gene Product Result for
Synonyms: HTSS2 K6IRS4 KRT5C KRT6IRS4
UniProtKB ID: Q7RTS7, B5MD61, Q86Y45
Gene ID:
Human(121391) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This protein belongs to a family of keratins that are specifically expressed in the inner root sheath of hair follicles.[provided by RefSeq, Jun 2009]
Mouse(406222) keratin 74
dog(486521) keratin 74
cow(525034) keratin 74
sheep(101110490) keratin 74
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175053 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175053 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175053 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001003669 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003669 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003669 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU146401 MISSION® esiRNA esiRNA human KRT74 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175053 Rosetta Predictions human pricing
NM_001003669 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368946 predicted 733
2 SASI_Hs01_00045529 predicted 1923
3 SASI_Hs02_00368947 predicted 1156
4 SASI_Hs01_00045531 predicted 1924
5 SASI_Hs01_00045533 predicted 1736
6 SASI_Hs01_00045534 predicted 1835
7 SASI_Hs01_00045536 predicted 1611
8 SASI_Hs02_00368948 predicted 1809
9 SASI_Hs02_00368949 predicted 722
10 SASI_Hs02_00368950 predicted 1740
11 SASI_Hs01_00045530 predicted 740
12 SASI_Hs01_00045532 predicted 735
13 SASI_Hs01_00045535 predicted 735
14 SASI_Hs01_00045537 predicted 857
15 SASI_Hs01_00045538 predicted 1411
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003669 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062415 predicted 1001
2 SASI_Mm01_00062416 predicted 595
3 SASI_Mm01_00062417 predicted 708
4 SASI_Mm01_00062418 predicted 576
5 SASI_Mm01_00062419 predicted 268
6 SASI_Mm01_00062420 predicted 485
7 SASI_Mm01_00062421 predicted 719
8 SASI_Mm01_00062422 predicted 723
9 SASI_Mm01_00062423 predicted 589
10 SASI_Mm01_00062424 predicted 1260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175053
KRT74 MISSION shRNA Bacterial Glycerol Stock
keratin 74
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175053.2-2243s1c1
Sequence:CCGGCCTCCTTCATTATCAGCAATACTCGAGTATTGCTGATAATGAAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-846s1c1
Sequence:CCGGCTCACTGGACAAAGACATCAACTCGAGTTGATGTCTTTGTCCAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-75s1c1
Sequence:CCGGCAGTGGTGACAAGGGCAACTTCTCGAGAAGTTGCCCTTGTCACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-220s1c1
Sequence:CCGGCGTATTTCTTTCAATGTGGCTCTCGAGAGCCACATTGAAAGAAATACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-876s1c1
Sequence:CCGGGTGTCTGTATGATGCAGAGATCTCGAGATCTCTGCATCATACAGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-1150s21c1
Sequence:CCGGATCCGGTGTGAGATCGGGAATCTCGAGATTCCCGATCTCACACCGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-733s21c1
Sequence:CCGGAGATATGAAGTGGAGATTAACCTCGAGGTTAATCTCCACTTCATATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-2117s21c1
Sequence:CCGGCTTTGCAGGATGACGCCAATACTCGAGTATTGGCGTCATCCTGCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-1836s21c1
Sequence:CCGGTGGACTAACGACTTCTCATTTCTCGAGAAATGAGAAGTCGTTAGTCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175053
KRT74 MISSION shRNA shRNA Plasmid DNA
keratin 74
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175053.2-2243s1c1
Sequence:CCGGCCTCCTTCATTATCAGCAATACTCGAGTATTGCTGATAATGAAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-846s1c1
Sequence:CCGGCTCACTGGACAAAGACATCAACTCGAGTTGATGTCTTTGTCCAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-75s1c1
Sequence:CCGGCAGTGGTGACAAGGGCAACTTCTCGAGAAGTTGCCCTTGTCACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-220s1c1
Sequence:CCGGCGTATTTCTTTCAATGTGGCTCTCGAGAGCCACATTGAAAGAAATACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-876s1c1
Sequence:CCGGGTGTCTGTATGATGCAGAGATCTCGAGATCTCTGCATCATACAGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-1150s21c1
Sequence:CCGGATCCGGTGTGAGATCGGGAATCTCGAGATTCCCGATCTCACACCGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-733s21c1
Sequence:CCGGAGATATGAAGTGGAGATTAACCTCGAGGTTAATCTCCACTTCATATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-2117s21c1
Sequence:CCGGCTTTGCAGGATGACGCCAATACTCGAGTATTGGCGTCATCCTGCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-1836s21c1
Sequence:CCGGTGGACTAACGACTTCTCATTTCTCGAGAAATGAGAAGTCGTTAGTCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175053
KRT74 MISSION shRNA Lentiviral Transduction Particles
keratin 74
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116927    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175053.2-2243s1c1
Sequence:CCGGCCTCCTTCATTATCAGCAATACTCGAGTATTGCTGATAATGAAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-846s1c1
Sequence:CCGGCTCACTGGACAAAGACATCAACTCGAGTTGATGTCTTTGTCCAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-75s1c1
Sequence:CCGGCAGTGGTGACAAGGGCAACTTCTCGAGAAGTTGCCCTTGTCACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116929    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-220s1c1
Sequence:CCGGCGTATTTCTTTCAATGTGGCTCTCGAGAGCCACATTGAAAGAAATACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175053.2-876s1c1
Sequence:CCGGGTGTCTGTATGATGCAGAGATCTCGAGATCTCTGCATCATACAGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-1150s21c1
Sequence:CCGGATCCGGTGTGAGATCGGGAATCTCGAGATTCCCGATCTCACACCGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175053.3-733s21c1
Sequence:CCGGAGATATGAAGTGGAGATTAACCTCGAGGTTAATCTCCACTTCATATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413397    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-2117s21c1
Sequence:CCGGCTTTGCAGGATGACGCCAATACTCGAGTATTGGCGTCATCCTGCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175053.3-1836s21c1
Sequence:CCGGTGGACTAACGACTTCTCATTTCTCGAGAAATGAGAAGTCGTTAGTCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003669
KRT74 MISSION shRNA Bacterial Glycerol Stock
keratin 74
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000090414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-69s1c1
Sequence:CCGGGAATCAGCATACTTCCTACAACTCGAGTTGTAGGAAGTATGCTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-1248s1c1
Sequence:CCGGGAACAGGATGTCTGGTGAGAACTCGAGTTCTCACCAGACATCCTGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-120s1c1
Sequence:CCGGGCACAGCTTTGGATATGGGTACTCGAGTACCCATATCCAAAGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-590s1c1
Sequence:CCGGAGGTTGAGATTACCCAACGTACTCGAGTACGTTGGGTAATCTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003669
KRT74 MISSION shRNA shRNA Plasmid DNA
keratin 74
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000090414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-69s1c1
Sequence:CCGGGAATCAGCATACTTCCTACAACTCGAGTTGTAGGAAGTATGCTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-1248s1c1
Sequence:CCGGGAACAGGATGTCTGGTGAGAACTCGAGTTCTCACCAGACATCCTGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-120s1c1
Sequence:CCGGGCACAGCTTTGGATATGGGTACTCGAGTACCCATATCCAAAGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-590s1c1
Sequence:CCGGAGGTTGAGATTACCCAACGTACTCGAGTACGTTGGGTAATCTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003669
KRT74 MISSION shRNA Lentiviral Transduction Particles
keratin 74
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000090414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-69s1c1
Sequence:CCGGGAATCAGCATACTTCCTACAACTCGAGTTGTAGGAAGTATGCTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-1248s1c1
Sequence:CCGGGAACAGGATGTCTGGTGAGAACTCGAGTTCTCACCAGACATCCTGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-120s1c1
Sequence:CCGGGCACAGCTTTGGATATGGGTACTCGAGTACCCATATCCAAAGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003669.1-590s1c1
Sequence:CCGGAGGTTGAGATTACCCAACGTACTCGAGTACGTTGGGTAATCTCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)