EMAIL THIS PAGE TO A FRIEND

KRT75

keratin 75

51 Gene Product Result for
Synonyms: K6HF KB18 PFB
UniProtKB ID: O95678, B4DQU4, Q9NSA9
Gene ID:
Human(9119) Summary: This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
Mouse(109052) keratin 75
Rat(300247) keratin 75
chicken(408042) keratin 75
dog(100683813) keratin 75
cow(539683) keratin 75
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133357 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133357 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133357 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025311 MISSION® esiRNA esiRNA human KRT75 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004693 Rosetta Predictions human pricing
NM_001008828 Rosetta Predictions rat pricing
NM_133357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091345 predicted 1111
2 SASI_Hs01_00091346 predicted 1153
3 SASI_Hs01_00091347 predicted 1108
4 SASI_Hs01_00091348 predicted 1173
5 SASI_Hs01_00091349 predicted 700
6 SASI_Hs02_00338133 predicted 610
7 SASI_Hs01_00091351 predicted 617
8 SASI_Hs01_00091353 predicted 417
9 SASI_Hs02_00338134 predicted 1619
10 SASI_Hs01_00091354 predicted 1101
11 SASI_Hs01_00091350 predicted 794
12 SASI_Hs01_00091352 predicted 809
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063490 predicted 257
2 SASI_Rn01_00063491 predicted 392
3 SASI_Rn01_00063492 predicted 262
4 SASI_Rn01_00063493 predicted 207
5 SASI_Rn01_00063494 predicted 654
6 SASI_Rn01_00063495 predicted 395
7 SASI_Rn01_00063496 predicted 212
8 SASI_Rn01_00063497 predicted 807
9 SASI_Rn01_00063498 predicted 1122
10 SASI_Rn01_00063499 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158646 predicted 1803
2 SASI_Mm01_00158647 predicted 494
3 SASI_Mm01_00158648 predicted 1236
4 SASI_Mm01_00158649 predicted 908
5 SASI_Mm01_00158650 predicted 1165
6 SASI_Mm01_00158651 predicted 851
7 SASI_Mm01_00158652 predicted 917
8 SASI_Mm01_00158653 predicted 781
9 SASI_Mm01_00158654 predicted 426
10 SASI_Mm01_00158655 predicted 1158
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004693
KRT75 MISSION shRNA Bacterial Glycerol Stock
keratin 75
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004693.2-1097s21c1
Sequence:CCGGGACCTTCGAAACACCAAACAACTCGAGTTGTTTGGTGTTTCGAAGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004693.2-1796s21c1
Sequence:CCGGGAGTACTGGCTATACCCATTCCTCGAGGAATGGGTATAGCCAGTACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-987s1c1
Sequence:CCGGCAAAGCACAATACGAGGACATCTCGAGATGTCCTCGTATTGTGCTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1119s1c1
Sequence:CCGGCTCTGAAATGAACCGCATGATCTCGAGATCATGCGGTTCATTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1611s1c1
Sequence:CCGGCAGTGGTTCTAGCGTCAAGTTCTCGAGAACTTGACGCTAGAACCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004693.1-1865s1c1
Sequence:CCGGCCCGTCTGTTACACATGTGAACTCGAGTTCACATGTGTAACAGACGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-727s1c1
Sequence:CCGGGTCAGGTACGAAGATGAAATTCTCGAGAATTTCATCTTCGTACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004693
KRT75 MISSION shRNA shRNA Plasmid DNA
keratin 75
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004693.2-1097s21c1
Sequence:CCGGGACCTTCGAAACACCAAACAACTCGAGTTGTTTGGTGTTTCGAAGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004693.2-1796s21c1
Sequence:CCGGGAGTACTGGCTATACCCATTCCTCGAGGAATGGGTATAGCCAGTACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-987s1c1
Sequence:CCGGCAAAGCACAATACGAGGACATCTCGAGATGTCCTCGTATTGTGCTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1119s1c1
Sequence:CCGGCTCTGAAATGAACCGCATGATCTCGAGATCATGCGGTTCATTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1611s1c1
Sequence:CCGGCAGTGGTTCTAGCGTCAAGTTCTCGAGAACTTGACGCTAGAACCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004693.1-1865s1c1
Sequence:CCGGCCCGTCTGTTACACATGTGAACTCGAGTTCACATGTGTAACAGACGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000082986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-727s1c1
Sequence:CCGGGTCAGGTACGAAGATGAAATTCTCGAGAATTTCATCTTCGTACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004693
KRT75 MISSION shRNA Lentiviral Transduction Particles
keratin 75
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004693.2-1097s21c1
Sequence:CCGGGACCTTCGAAACACCAAACAACTCGAGTTGTTTGGTGTTTCGAAGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004693.2-1796s21c1
Sequence:CCGGGAGTACTGGCTATACCCATTCCTCGAGGAATGGGTATAGCCAGTACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-987s1c1
Sequence:CCGGCAAAGCACAATACGAGGACATCTCGAGATGTCCTCGTATTGTGCTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1119s1c1
Sequence:CCGGCTCTGAAATGAACCGCATGATCTCGAGATCATGCGGTTCATTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-1611s1c1
Sequence:CCGGCAGTGGTTCTAGCGTCAAGTTCTCGAGAACTTGACGCTAGAACCACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082983    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004693.1-1865s1c1
Sequence:CCGGCCCGTCTGTTACACATGTGAACTCGAGTTCACATGTGTAACAGACGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000082986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004693.1-727s1c1
Sequence:CCGGGTCAGGTACGAAGATGAAATTCTCGAGAATTTCATCTTCGTACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133357
KRT75 MISSION shRNA Bacterial Glycerol Stock
keratin 75
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-217s1c1
Sequence:CCGGGCAGGATCAGTGGTATTGGTTCTCGAGAACCAATACCACTGATCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-666s1c1
Sequence:CCGGGAGCCTTTCTTCGATACATATCTCGAGATATGTATCGAAGAAAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-786s1c1
Sequence:CCGGGTCAGGTATGAAGACGAAATTCTCGAGAATTTCGTCTTCATACCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-1157s1c1
Sequence:CCGGCCGCAACACCAAACAAGAGATCTCGAGATCTCTTGTTTGGTGTTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-1700s21c1
Sequence:CCGGACATCATCCAGAAAGAGTTACCTCGAGGTAACTCTTTCTGGATGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-921s21c1
Sequence:CCGGACTTCTACCGGATGATCTATGCTCGAGCATAGATCATCCGGTAGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133357.1-1959s1c1
Sequence:CCGGCCCTCCAAAGTTCACAATAAACTCGAGTTTATTGTGAACTTTGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133357
KRT75 MISSION shRNA shRNA Plasmid DNA
keratin 75
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-217s1c1
Sequence:CCGGGCAGGATCAGTGGTATTGGTTCTCGAGAACCAATACCACTGATCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-666s1c1
Sequence:CCGGGAGCCTTTCTTCGATACATATCTCGAGATATGTATCGAAGAAAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-786s1c1
Sequence:CCGGGTCAGGTATGAAGACGAAATTCTCGAGAATTTCGTCTTCATACCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-1157s1c1
Sequence:CCGGCCGCAACACCAAACAAGAGATCTCGAGATCTCTTGTTTGGTGTTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-1700s21c1
Sequence:CCGGACATCATCCAGAAAGAGTTACCTCGAGGTAACTCTTTCTGGATGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-921s21c1
Sequence:CCGGACTTCTACCGGATGATCTATGCTCGAGCATAGATCATCCGGTAGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133357.1-1959s1c1
Sequence:CCGGCCCTCCAAAGTTCACAATAAACTCGAGTTTATTGTGAACTTTGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133357
KRT75 MISSION shRNA Lentiviral Transduction Particles
keratin 75
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-217s1c1
Sequence:CCGGGCAGGATCAGTGGTATTGGTTCTCGAGAACCAATACCACTGATCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-666s1c1
Sequence:CCGGGAGCCTTTCTTCGATACATATCTCGAGATATGTATCGAAGAAAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-786s1c1
Sequence:CCGGGTCAGGTATGAAGACGAAATTCTCGAGAATTTCGTCTTCATACCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133357.1-1157s1c1
Sequence:CCGGCCGCAACACCAAACAAGAGATCTCGAGATCTCTTGTTTGGTGTTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-1700s21c1
Sequence:CCGGACATCATCCAGAAAGAGTTACCTCGAGGTAACTCTTTCTGGATGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434472    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133357.3-921s21c1
Sequence:CCGGACTTCTACCGGATGATCTATGCTCGAGCATAGATCATCCGGTAGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133357.1-1959s1c1
Sequence:CCGGCCCTCCAAAGTTCACAATAAACTCGAGTTTATTGTGAACTTTGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)