EMAIL THIS PAGE TO A FRIEND

KRT76

keratin 76

138 Gene Product Result for
Synonyms: HUMCYT2A KRT2B KRT2P
UniProtKB ID: Q01546, B4DRR3, Q7Z795
Gene ID:
Human(51350) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. The type II keratins are clustered in a region of chromosome 12q13. [provided by RefSeq, Jun 2009]
Mouse(77055) keratin 76
Rat(407757) keratin 76
cow(407189) keratin 76
dog(486518) keratin 76
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_128174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_128174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_128174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015848 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015848 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015848 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015848 Rosetta Predictions human pricing
NM_001008805 Rosetta Predictions rat pricing
NM_001033177 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015848 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052970 predicted 936
2 SASI_Hs01_00052971 predicted 1986
3 SASI_Hs01_00052972 predicted 1383
4 SASI_Hs01_00052973 predicted 1217
5 SASI_Hs01_00052974 predicted 983
6 SASI_Hs01_00052975 predicted 756
7 SASI_Hs01_00052976 predicted 2045
8 SASI_Hs01_00052977 predicted 737
9 SASI_Hs02_00348436 predicted 1972
10 SASI_Hs02_00348437 predicted 962
11 SASI_Hs01_00052968 predicted 2246
12 SASI_Hs01_00052969 predicted 1354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040677 predicted 1014
2 SASI_Rn01_00040678 predicted 649
3 SASI_Rn01_00040679 predicted 866
4 SASI_Rn01_00040680 predicted 469
5 SASI_Rn01_00040681 predicted 617
6 SASI_Rn01_00040682 predicted 1014
7 SASI_Rn01_00040683 predicted 758
8 SASI_Rn01_00040684 predicted 616
9 SASI_Rn01_00040685 predicted 863
10 SASI_Rn01_00040686 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033177 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141294 predicted 1933
2 SASI_Mm01_00141295 predicted 246
3 SASI_Mm01_00141296 predicted 940
4 SASI_Mm01_00141297 predicted 885
5 SASI_Mm01_00141298 predicted 923
6 SASI_Mm01_00141300 predicted 695
7 SASI_Mm01_00141301 predicted 992
8 SASI_Mm02_00288288 predicted 895
9 SASI_Mm01_00141302 predicted 1201
10 SASI_Mm01_00141303 predicted 1337
11 SASI_Mm01_00141299 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_128174
KRT76 MISSION shRNA Bacterial Glycerol Stock
keratin 76
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128174.4-1979s1c1
Sequence:CCGGCCGAACTTCTTTGCTCCTATACTCGAGTATAGGAGCAAAGAAGTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-247s1c1
Sequence:CCGGTGGCAGTAAGAGTATTTCTATCTCGAGATAGAAATACTCTTACTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-736s1c1
Sequence:CCGGGCGCAAGCAGTTAGATTCACTCTCGAGAGTGAATCTAACTGCTTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-737s1c1
Sequence:CCGGCGCAAGCAGTTAGATTCACTTCTCGAGAAGTGAATCTAACTGCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-1714s1c1
Sequence:CCGGCCAGCAGAGAATGGGCTTTAACTCGAGTTAAAGCCCATTCTCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_128174
KRT76 MISSION shRNA shRNA Plasmid DNA
keratin 76
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128174.4-1979s1c1
Sequence:CCGGCCGAACTTCTTTGCTCCTATACTCGAGTATAGGAGCAAAGAAGTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-247s1c1
Sequence:CCGGTGGCAGTAAGAGTATTTCTATCTCGAGATAGAAATACTCTTACTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-736s1c1
Sequence:CCGGGCGCAAGCAGTTAGATTCACTCTCGAGAGTGAATCTAACTGCTTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-737s1c1
Sequence:CCGGCGCAAGCAGTTAGATTCACTTCTCGAGAAGTGAATCTAACTGCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-1714s1c1
Sequence:CCGGCCAGCAGAGAATGGGCTTTAACTCGAGTTAAAGCCCATTCTCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_128174
KRT76 MISSION shRNA Lentiviral Transduction Particles
keratin 76
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091208    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_128174.4-1979s1c1
Sequence:CCGGCCGAACTTCTTTGCTCCTATACTCGAGTATAGGAGCAAAGAAGTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-247s1c1
Sequence:CCGGTGGCAGTAAGAGTATTTCTATCTCGAGATAGAAATACTCTTACTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-736s1c1
Sequence:CCGGGCGCAAGCAGTTAGATTCACTCTCGAGAGTGAATCTAACTGCTTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-737s1c1
Sequence:CCGGCGCAAGCAGTTAGATTCACTTCTCGAGAAGTGAATCTAACTGCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_128174.4-1714s1c1
Sequence:CCGGCCAGCAGAGAATGGGCTTTAACTCGAGTTAAAGCCCATTCTCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015848
KRT76 MISSION shRNA Bacterial Glycerol Stock
keratin 76
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015848.1-2258s1c1
Sequence:CCGGCTCCCATTCTTACTGGGAGTTCTCGAGAACTCCCAGTAAGAATGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1388s1c1
Sequence:CCGGGCCCTACAGAAGGCTAAGGATCTCGAGATCCTTAGCCTTCTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1544s1c1
Sequence:CCGGTGCATTTCAGTGGTCAGCAATCTCGAGATTGCTGACCACTGAAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-492s1c1
Sequence:CCGGGAATTCAGGAAGTGATTGTAACTCGAGTTACAATCACTTCCTGAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-961s1c1
Sequence:CCGGCCTGACAGATGAAGTCAGCTTCTCGAGAAGCTGACTTCATCTGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015848
KRT76 MISSION shRNA shRNA Plasmid DNA
keratin 76
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015848.1-2258s1c1
Sequence:CCGGCTCCCATTCTTACTGGGAGTTCTCGAGAACTCCCAGTAAGAATGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1388s1c1
Sequence:CCGGGCCCTACAGAAGGCTAAGGATCTCGAGATCCTTAGCCTTCTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1544s1c1
Sequence:CCGGTGCATTTCAGTGGTCAGCAATCTCGAGATTGCTGACCACTGAAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-492s1c1
Sequence:CCGGGAATTCAGGAAGTGATTGTAACTCGAGTTACAATCACTTCCTGAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-961s1c1
Sequence:CCGGCCTGACAGATGAAGTCAGCTTCTCGAGAAGCTGACTTCATCTGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015848
KRT76 MISSION shRNA Lentiviral Transduction Particles
keratin 76
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015848.1-2258s1c1
Sequence:CCGGCTCCCATTCTTACTGGGAGTTCTCGAGAACTCCCAGTAAGAATGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1388s1c1
Sequence:CCGGGCCCTACAGAAGGCTAAGGATCTCGAGATCCTTAGCCTTCTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-1544s1c1
Sequence:CCGGTGCATTTCAGTGGTCAGCAATCTCGAGATTGCTGACCACTGAAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-492s1c1
Sequence:CCGGGAATTCAGGAAGTGATTGTAACTCGAGTTACAATCACTTCCTGAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015848.1-961s1c1
Sequence:CCGGCCTGACAGATGAAGTCAGCTTCTCGAGAAGCTGACTTCATCTGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)