EMAIL THIS PAGE TO A FRIEND

KRT77

keratin 77

41 Gene Product Result for
Synonyms: K1B KRT1B
UniProtKB ID: Q7Z794, Q7RTS8
Gene ID:
Human(374454) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in the skin and eccrine sweat glands. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Mouse(406220) keratin 77
Rat(406226) keratin 77
sheep(101109161) keratin 77
dog(100683333) keratin 77
cow(100336698) keratin 77
Horse(100061792) keratin 77
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001003667 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001003667 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001003667 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175078 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175078 Rosetta Predictions human pricing
NM_001008807 Rosetta Predictions rat pricing
NM_001003667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060494 predicted 1884
2 SASI_Hs01_00060495 predicted 468
3 SASI_Hs01_00060496 predicted 369
4 SASI_Hs01_00060497 predicted 365
5 SASI_Hs01_00060498 predicted 853
6 SASI_Hs01_00060499 predicted 211
7 SASI_Hs01_00060501 predicted 490
8 SASI_Hs01_00060502 predicted 1887
9 SASI_Hs01_00060503 predicted 1939
10 SASI_Hs02_00368988 predicted 1926
11 SASI_Hs01_00060500 predicted 1248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049486 predicted 792
2 SASI_Rn01_00049487 predicted 350
3 SASI_Rn01_00049488 predicted 350
4 SASI_Rn01_00049490 predicted 798
5 SASI_Rn01_00049491 predicted 837
6 SASI_Rn01_00049492 predicted 893
7 SASI_Rn02_00199298 predicted 961
8 SASI_Rn01_00049493 predicted 927
9 SASI_Rn01_00049495 predicted 895
10 SASI_Rn02_00199299 predicted 409
11 SASI_Rn01_00049489 predicted 476
12 SASI_Rn01_00049494 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168692 predicted 1182
2 SASI_Mm01_00168693 predicted 834
3 SASI_Mm01_00168694 predicted 939
4 SASI_Mm01_00168695 predicted 894
5 SASI_Mm01_00168696 predicted 832
6 SASI_Mm01_00168697 predicted 997
7 SASI_Mm01_00168698 predicted 956
8 SASI_Mm01_00168699 predicted 1210
9 SASI_Mm01_00168700 predicted 1252
10 SASI_Mm01_00168701 predicted 961
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003667
KRT77 MISSION shRNA Bacterial Glycerol Stock
keratin 77
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000091796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-121s1c1
Sequence:CCGGAGGAGGTATGGCGGTGATTATCTCGAGATAATCACCGCCATACCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1219s1c1
Sequence:CCGGGAAGGGATGCACGGATTGATTCTCGAGAATCAATCCGTGCATCCCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-948s1c1
Sequence:CCGGCGTCAGTGATACCAATGTCATCTCGAGATGACATTGGTATCACTGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1024s1c1
Sequence:CCGGCGAGCCCAGTATGAAATAATTCTCGAGAATTATTTCATACTGGGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003667
KRT77 MISSION shRNA shRNA Plasmid DNA
keratin 77
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000091796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-121s1c1
Sequence:CCGGAGGAGGTATGGCGGTGATTATCTCGAGATAATCACCGCCATACCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1219s1c1
Sequence:CCGGGAAGGGATGCACGGATTGATTCTCGAGAATCAATCCGTGCATCCCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-948s1c1
Sequence:CCGGCGTCAGTGATACCAATGTCATCTCGAGATGACATTGGTATCACTGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1024s1c1
Sequence:CCGGCGAGCCCAGTATGAAATAATTCTCGAGAATTATTTCATACTGGGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003667
KRT77 MISSION shRNA Lentiviral Transduction Particles
keratin 77
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000091796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-121s1c1
Sequence:CCGGAGGAGGTATGGCGGTGATTATCTCGAGATAATCACCGCCATACCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1219s1c1
Sequence:CCGGGAAGGGATGCACGGATTGATTCTCGAGAATCAATCCGTGCATCCCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-948s1c1
Sequence:CCGGCGTCAGTGATACCAATGTCATCTCGAGATGACATTGGTATCACTGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003667.1-1024s1c1
Sequence:CCGGCGAGCCCAGTATGAAATAATTCTCGAGAATTATTTCATACTGGGCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175078
KRT77 MISSION shRNA Bacterial Glycerol Stock
keratin 77
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175078.1-1886s1c1
Sequence:CCGGGCCAATAAATTCGACTCTAATCTCGAGATTAGAGTCGAATTTATTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-491s1c1
Sequence:CCGGCCCTGAAATTCAGAGGATCAACTCGAGTTGATCCTCTGAATTTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-1044s1c1
Sequence:CCGGCGGACCCAGTATGAACTGATTCTCGAGAATCAGTTCATACTGGGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-527s1c1
Sequence:CCGGGCAGATTATGGTTCTCAACAACTCGAGTTGTTGAGAACCATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-78s1c1
Sequence:CCGGCGGGTTTATAGTACCAGCTCTCTCGAGAGAGCTGGTACTATAAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175078
KRT77 MISSION shRNA shRNA Plasmid DNA
keratin 77
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175078.1-1886s1c1
Sequence:CCGGGCCAATAAATTCGACTCTAATCTCGAGATTAGAGTCGAATTTATTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-491s1c1
Sequence:CCGGCCCTGAAATTCAGAGGATCAACTCGAGTTGATCCTCTGAATTTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-1044s1c1
Sequence:CCGGCGGACCCAGTATGAACTGATTCTCGAGAATCAGTTCATACTGGGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-527s1c1
Sequence:CCGGGCAGATTATGGTTCTCAACAACTCGAGTTGTTGAGAACCATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-78s1c1
Sequence:CCGGCGGGTTTATAGTACCAGCTCTCTCGAGAGAGCTGGTACTATAAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175078
KRT77 MISSION shRNA Lentiviral Transduction Particles
keratin 77
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116782    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175078.1-1886s1c1
Sequence:CCGGGCCAATAAATTCGACTCTAATCTCGAGATTAGAGTCGAATTTATTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-491s1c1
Sequence:CCGGCCCTGAAATTCAGAGGATCAACTCGAGTTGATCCTCTGAATTTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-1044s1c1
Sequence:CCGGCGGACCCAGTATGAACTGATTCTCGAGAATCAGTTCATACTGGGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-527s1c1
Sequence:CCGGGCAGATTATGGTTCTCAACAACTCGAGTTGTTGAGAACCATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175078.1-78s1c1
Sequence:CCGGCGGGTTTATAGTACCAGCTCTCTCGAGAGAGCTGGTACTATAAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)