EMAIL THIS PAGE TO A FRIEND

KRT78

keratin 78

49 Gene Product Result for
Synonyms: K5B Kb40
UniProtKB ID: Q8N1N4, A8K4D6, Q5HYM7, Q7RTT2
Gene ID:
Human(196374) Summary: This gene is a member of the type II keratin gene family and encodes a protein with an intermediate filament domain. Keratins are the major structural proteins in epithelial cells, forming a cytoplasmic network of 10 to 12 nm wide intermediate filaments and creating a scaffold that gives cells the ability to withstand mechanical and non-mechanical stresses. The genes of the type II keratin family are located as a gene cluster at 12p13.13. Four pseudogenes of this gene family have been identified. [provided by RefSeq, Jul 2008]
Mouse(332131) keratin 78
Rat(315324) keratin 78
dog(486514) keratin 78
cow(523221) keratin 78
sheep(101108376) keratin 78
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_212487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_212487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_212487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_173352 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173352 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173352 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173352 Rosetta Predictions human pricing
XM_001067238 Rosetta Predictions rat pricing
XM_235687 Rosetta Predictions rat pricing
NM_212487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173352 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035115 predicted 776
2 SASI_Hs01_00035117 predicted 1196
3 SASI_Hs01_00035118 predicted 1042
4 SASI_Hs01_00035119 predicted 932
5 SASI_Hs01_00035120 predicted 781
6 SASI_Hs01_00035121 predicted 1342
7 SASI_Hs01_00035122 predicted 1474
8 SASI_Hs01_00035124 predicted 1202
9 SASI_Hs02_00368182 predicted 648
10 SASI_Hs01_00035116 predicted 1015
11 SASI_Hs01_00035123 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067238 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00320357 predicted 1881
2 SASI_Rn02_00320358 predicted 1210
3 SASI_Rn02_00320359 predicted 849
4 SASI_Rn02_00320360 predicted 910
5 SASI_Rn02_00320361 predicted 856
6 SASI_Rn02_00320362 predicted 2509
7 SASI_Rn02_00320363 predicted 1913
8 SASI_Rn02_00320364 predicted 1089
9 SASI_Rn02_00320365 predicted 1244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235687 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00150308 predicted 679
2 SASI_Rn01_00150309 predicted 1211
3 SASI_Rn01_00150310 predicted 851
4 SASI_Rn01_00150311 predicted 911
5 SASI_Rn01_00150312 predicted 1236
6 SASI_Rn01_00150313 predicted 1095
7 SASI_Rn01_00150314 predicted 965
8 SASI_Rn01_00150315 predicted 387
9 SASI_Rn01_00150316 predicted 383
10 SASI_Rn01_00150317 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352287 predicted 3166
2 SASI_Mm01_00201647 predicted 382
3 SASI_Mm01_00201649 predicted 909
4 SASI_Mm01_00201650 predicted 794
5 SASI_Mm01_00201651 predicted 954
6 SASI_Mm01_00201652 predicted 403
7 SASI_Mm01_00201653 predicted 1235
8 SASI_Mm02_00352288 predicted 3107
9 SASI_Mm01_00201655 predicted 977
10 SASI_Mm01_00201656 predicted 508
11 SASI_Mm01_00201648 predicted 883
12 SASI_Mm01_00201654 predicted 1156
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_212487
KRT78 MISSION shRNA Bacterial Glycerol Stock
keratin 78
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-318s1c1
Sequence:CCGGTCGAGAGATCAGAAGCCTCAACTCGAGTTGAGGCTTCTGATCTCTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1328s1c1
Sequence:CCGGGCCAAGTAGTTGTGCCTGGAACTCGAGTTCCAGGCACAACTACTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-789s1c1
Sequence:CCGGCATGGATAACAATCGTTGCTTCTCGAGAAGCAACGATTGTTATCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1271s1c1
Sequence:CCGGGCCAGGTCACTGTGTCTATAACTCGAGTTATAGACACAGTGACCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1862s1c1
Sequence:CCGGTGACCATTCCTGGAAGAGAATCTCGAGATTCTCTTCCAGGAATGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_212487
KRT78 MISSION shRNA shRNA Plasmid DNA
keratin 78
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-318s1c1
Sequence:CCGGTCGAGAGATCAGAAGCCTCAACTCGAGTTGAGGCTTCTGATCTCTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1328s1c1
Sequence:CCGGGCCAAGTAGTTGTGCCTGGAACTCGAGTTCCAGGCACAACTACTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-789s1c1
Sequence:CCGGCATGGATAACAATCGTTGCTTCTCGAGAAGCAACGATTGTTATCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1271s1c1
Sequence:CCGGGCCAGGTCACTGTGTCTATAACTCGAGTTATAGACACAGTGACCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1862s1c1
Sequence:CCGGTGACCATTCCTGGAAGAGAATCTCGAGATTCTCTTCCAGGAATGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_212487
KRT78 MISSION shRNA Lentiviral Transduction Particles
keratin 78
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-318s1c1
Sequence:CCGGTCGAGAGATCAGAAGCCTCAACTCGAGTTGAGGCTTCTGATCTCTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1328s1c1
Sequence:CCGGGCCAAGTAGTTGTGCCTGGAACTCGAGTTCCAGGCACAACTACTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-789s1c1
Sequence:CCGGCATGGATAACAATCGTTGCTTCTCGAGAAGCAACGATTGTTATCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1271s1c1
Sequence:CCGGGCCAGGTCACTGTGTCTATAACTCGAGTTATAGACACAGTGACCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_212487.2-1862s1c1
Sequence:CCGGTGACCATTCCTGGAAGAGAATCTCGAGATTCTCTTCCAGGAATGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173352
KRT78 MISSION shRNA Bacterial Glycerol Stock
keratin 78
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173352.1-1770s1c1
Sequence:CCGGCCTGCTGTTCTGAATGCTCTACTCGAGTAGAGCATTCAGAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-347s1c1
Sequence:CCGGCCACTGAAGATTGAGATCGATCTCGAGATCGATCTCAATCTTCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1588s1c1
Sequence:CCGGGACAGTTGAGTCGAGTCTGAACTCGAGTTCAGACTCGACTCAACTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1030s1c1
Sequence:CCGGGCAGGAAACGAAAGTCCAGATCTCGAGATCTGGACTTTCGTTTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-689s1c1
Sequence:CCGGGCCACACTTGAGAACGACTTTCTCGAGAAAGTCGTTCTCAAGTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173352
KRT78 MISSION shRNA shRNA Plasmid DNA
keratin 78
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173352.1-1770s1c1
Sequence:CCGGCCTGCTGTTCTGAATGCTCTACTCGAGTAGAGCATTCAGAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-347s1c1
Sequence:CCGGCCACTGAAGATTGAGATCGATCTCGAGATCGATCTCAATCTTCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1588s1c1
Sequence:CCGGGACAGTTGAGTCGAGTCTGAACTCGAGTTCAGACTCGACTCAACTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1030s1c1
Sequence:CCGGGCAGGAAACGAAAGTCCAGATCTCGAGATCTGGACTTTCGTTTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-689s1c1
Sequence:CCGGGCCACACTTGAGAACGACTTTCTCGAGAAAGTCGTTCTCAAGTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173352
KRT78 MISSION shRNA Lentiviral Transduction Particles
keratin 78
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117052    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173352.1-1770s1c1
Sequence:CCGGCCTGCTGTTCTGAATGCTCTACTCGAGTAGAGCATTCAGAACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-347s1c1
Sequence:CCGGCCACTGAAGATTGAGATCGATCTCGAGATCGATCTCAATCTTCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117055    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1588s1c1
Sequence:CCGGGACAGTTGAGTCGAGTCTGAACTCGAGTTCAGACTCGACTCAACTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-1030s1c1
Sequence:CCGGGCAGGAAACGAAAGTCCAGATCTCGAGATCTGGACTTTCGTTTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117053    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173352.1-689s1c1
Sequence:CCGGGCCACACTTGAGAACGACTTTCTCGAGAAAGTCGTTCTCAAGTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)