EMAIL THIS PAGE TO A FRIEND

KRT79

keratin 79

78 Gene Product Result for
Synonyms: K6L KRT6L
UniProtKB ID: Q5XKE5, Q6P465, Q7Z793
Gene ID:
Human(338785) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]
Mouse(223917) keratin 79
Rat(683720) keratin 79
sheep(101108641) keratin 79
dog(486515) keratin 79
cow(508202) keratin 79
Horse(100061886) keratin 79
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146063 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146063 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146063 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175834 Rosetta Predictions human pricing
XR_009563 Rosetta Predictions rat pricing
NM_146063 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227149 predicted 1100
2 SASI_Hs01_00227150 predicted 1844
3 SASI_Hs01_00227151 predicted 573
4 SASI_Hs01_00227153 predicted 850
5 SASI_Hs01_00227154 predicted 337
6 SASI_Hs01_00227155 predicted 920
7 SASI_Hs01_00227156 predicted 1764
8 SASI_Hs01_00227157 predicted 1408
9 SASI_Hs02_00369116 predicted 1775
10 SASI_Hs01_00227152 predicted 810
11 SASI_Hs01_00227158 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420157 predicted 510
2 SASI_Rn02_00420158 predicted 661
3 SASI_Rn02_00420159 predicted 706
4 SASI_Rn02_00420160 predicted 808
5 SASI_Rn02_00420161 predicted 712
6 SASI_Rn02_00420162 predicted 694
7 SASI_Rn02_00420163 predicted 537
8 SASI_Rn02_00420164 predicted 513
9 SASI_Rn02_00420165 predicted 244
10 SASI_Rn02_00420166 predicted 337
11 SASI_Rn01_00157532 predicted 1475
12 SASI_Rn01_00157533 predicted 1379
13 SASI_Rn01_00157534 predicted 1414
14 SASI_Rn01_00157535 predicted 1370
15 SASI_Rn01_00157536 predicted 1372
16 SASI_Rn01_00157537 predicted 1427
17 SASI_Rn01_00157538 predicted 1440
18 SASI_Rn01_00157539 predicted 1341
19 SASI_Rn01_00157540 predicted 1435
20 SASI_Rn01_00157541 predicted 1434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146063 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117651 predicted 882
2 SASI_Mm01_00117652 predicted 865
3 SASI_Mm01_00117653 predicted 1465
4 SASI_Mm01_00117654 predicted 409
5 SASI_Mm01_00117655 predicted 1677
6 SASI_Mm02_00341680 predicted 399
7 SASI_Mm01_00117656 predicted 1311
8 SASI_Mm01_00117657 predicted 1779
9 SASI_Mm01_00117660 predicted 1696
10 SASI_Mm02_00341681 predicted 491
11 SASI_Mm01_00117658 predicted 562
12 SASI_Mm01_00117659 predicted 1308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175834
KRT79 MISSION shRNA Bacterial Glycerol Stock
keratin 79
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175834.2-1793s1c1
Sequence:CCGGCGCTCAAATCTACTCAGGTTTCTCGAGAAACCTGAGTAGATTTGAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1599s1c1
Sequence:CCGGGCGGAAGACCACTACGGTCAACTCGAGTTGACCGTAGTGGTCTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-233s1c1
Sequence:CCGGGCCACAAGAGTATCTCTGTCACTCGAGTGACAGAGATACTCTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1524s1c1
Sequence:CCGGCAAGGGTGGATTCAGCACAAACTCGAGTTTGTGCTGAATCCACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-817s1c1
Sequence:CCGGCGGATGGATCTGCATGGCAAACTCGAGTTTGCCATGCAGATCCATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-908s21c1
Sequence:CCGGCCCACGTGTCTAACACCAATGCTCGAGCATTGGTGTTAGACACGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-1100s21c1
Sequence:CCGGGGGACACCAAGAACGAGATTGCTCGAGCAATCTCGTTCTTGGTGTCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175834
KRT79 MISSION shRNA shRNA Plasmid DNA
keratin 79
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175834.2-1793s1c1
Sequence:CCGGCGCTCAAATCTACTCAGGTTTCTCGAGAAACCTGAGTAGATTTGAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1599s1c1
Sequence:CCGGGCGGAAGACCACTACGGTCAACTCGAGTTGACCGTAGTGGTCTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-233s1c1
Sequence:CCGGGCCACAAGAGTATCTCTGTCACTCGAGTGACAGAGATACTCTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1524s1c1
Sequence:CCGGCAAGGGTGGATTCAGCACAAACTCGAGTTTGTGCTGAATCCACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-817s1c1
Sequence:CCGGCGGATGGATCTGCATGGCAAACTCGAGTTTGCCATGCAGATCCATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-908s21c1
Sequence:CCGGCCCACGTGTCTAACACCAATGCTCGAGCATTGGTGTTAGACACGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-1100s21c1
Sequence:CCGGGGGACACCAAGAACGAGATTGCTCGAGCAATCTCGTTCTTGGTGTCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175834
KRT79 MISSION shRNA Lentiviral Transduction Particles
keratin 79
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116502    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175834.2-1793s1c1
Sequence:CCGGCGCTCAAATCTACTCAGGTTTCTCGAGAAACCTGAGTAGATTTGAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1599s1c1
Sequence:CCGGGCGGAAGACCACTACGGTCAACTCGAGTTGACCGTAGTGGTCTTCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-233s1c1
Sequence:CCGGGCCACAAGAGTATCTCTGTCACTCGAGTGACAGAGATACTCTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-1524s1c1
Sequence:CCGGCAAGGGTGGATTCAGCACAAACTCGAGTTTGTGCTGAATCCACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175834.2-817s1c1
Sequence:CCGGCGGATGGATCTGCATGGCAAACTCGAGTTTGCCATGCAGATCCATCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-908s21c1
Sequence:CCGGCCCACGTGTCTAACACCAATGCTCGAGCATTGGTGTTAGACACGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175834.2-1100s21c1
Sequence:CCGGGGGACACCAAGAACGAGATTGCTCGAGCAATCTCGTTCTTGGTGTCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146063
KRT79 MISSION shRNA Bacterial Glycerol Stock
keratin 79
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146063.1-1807s1c1
Sequence:CCGGGCATTTGGGAAAGGGCTCAAACTCGAGTTTGAGCCCTTTCCCAAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-977s1c1
Sequence:CCGGTGTGTCTGACACCAACGTGATCTCGAGATCACGTTGGTGTCAGACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-1308s1c1
Sequence:CCGGGCTAAGAAGAAGCTTGGAGATCTCGAGATCTCCAAGCTTCTTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-755s1c1
Sequence:CCGGGCTGAGGAACGTACAGGATAACTCGAGTTATCCTGTACGTTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-311s1c1
Sequence:CCGGCAAGAATATCTCCGTCAGCATCTCGAGATGCTGACGGAGATATTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-204s21c1
Sequence:CCGGAGCTACAGCTCAGTGACTATGCTCGAGCATAGTCACTGAGCTGTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146063.1-1858s21c1
Sequence:CCGGGTGGAATGGGAGGGAAGTTAGCTCGAGCTAACTTCCCTCCCATTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-907s21c1
Sequence:CCGGACAGCTTGACACAAGAGATTGCTCGAGCAATCTCTTGTGTCAAGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-1682s21c1
Sequence:CCGGCAAGACCTCTAGCCGGAGATACTCGAGTATCTCCGGCTAGAGGTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146063
KRT79 MISSION shRNA shRNA Plasmid DNA
keratin 79
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146063.1-1807s1c1
Sequence:CCGGGCATTTGGGAAAGGGCTCAAACTCGAGTTTGAGCCCTTTCCCAAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-977s1c1
Sequence:CCGGTGTGTCTGACACCAACGTGATCTCGAGATCACGTTGGTGTCAGACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-1308s1c1
Sequence:CCGGGCTAAGAAGAAGCTTGGAGATCTCGAGATCTCCAAGCTTCTTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-755s1c1
Sequence:CCGGGCTGAGGAACGTACAGGATAACTCGAGTTATCCTGTACGTTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-311s1c1
Sequence:CCGGCAAGAATATCTCCGTCAGCATCTCGAGATGCTGACGGAGATATTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-204s21c1
Sequence:CCGGAGCTACAGCTCAGTGACTATGCTCGAGCATAGTCACTGAGCTGTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146063.1-1858s21c1
Sequence:CCGGGTGGAATGGGAGGGAAGTTAGCTCGAGCTAACTTCCCTCCCATTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-907s21c1
Sequence:CCGGACAGCTTGACACAAGAGATTGCTCGAGCAATCTCTTGTGTCAAGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-1682s21c1
Sequence:CCGGCAAGACCTCTAGCCGGAGATACTCGAGTATCTCCGGCTAGAGGTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146063
KRT79 MISSION shRNA Lentiviral Transduction Particles
keratin 79
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146063.1-1807s1c1
Sequence:CCGGGCATTTGGGAAAGGGCTCAAACTCGAGTTTGAGCCCTTTCCCAAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089735    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-977s1c1
Sequence:CCGGTGTGTCTGACACCAACGTGATCTCGAGATCACGTTGGTGTCAGACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-1308s1c1
Sequence:CCGGGCTAAGAAGAAGCTTGGAGATCTCGAGATCTCCAAGCTTCTTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089736    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-755s1c1
Sequence:CCGGGCTGAGGAACGTACAGGATAACTCGAGTTATCCTGTACGTTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146063.1-311s1c1
Sequence:CCGGCAAGAATATCTCCGTCAGCATCTCGAGATGCTGACGGAGATATTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-204s21c1
Sequence:CCGGAGCTACAGCTCAGTGACTATGCTCGAGCATAGTCACTGAGCTGTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146063.1-1858s21c1
Sequence:CCGGGTGGAATGGGAGGGAAGTTAGCTCGAGCTAACTTCCCTCCCATTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-907s21c1
Sequence:CCGGACAGCTTGACACAAGAGATTGCTCGAGCAATCTCTTGTGTCAAGCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146063.1-1682s21c1
Sequence:CCGGCAAGACCTCTAGCCGGAGATACTCGAGTATCTCCGGCTAGAGGTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)