EMAIL THIS PAGE TO A FRIEND

KRT7

keratin 7

49 Gene Product Result for
Synonyms: CK7 K2C7 K7 SCL
UniProtKB ID: P08729, Q92676, Q9BUD8, Q9Y3R7
Gene ID:
Human(3855) Summary: The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in the simple epithelia lining the cavities of the internal organs and in the gland ducts and blood vessels. The genes encoding the type II cytokeratins are clustered in a region of chromosome 12q12-q13. Alternative splicing may result in several transcript variants; however, not all variants have been fully described. [provided by RefSeq, Jul 2008]
Mouse(110310) keratin 7
Rat(300242) keratin 7
chicken(395772) keratin 7
cow(535697) keratin 7
Horse(100062790) keratin 7
dog(477602) keratin 7
sheep(101112716) keratin 7
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005556 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005556 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005556 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_033073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_033073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_033073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005556 Rosetta Predictions human pricing
NM_001047870 Rosetta Predictions rat pricing
NM_033073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005556 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243070 predicted 1342
2 SASI_Hs01_00243071 predicted 808
3 SASI_Hs01_00243072 predicted 1026
4 SASI_Hs01_00243073 predicted 765
5 SASI_Hs02_00339809 predicted 1077
6 SASI_Hs01_00243074 predicted 769
7 SASI_Hs01_00243075 predicted 1348
8 SASI_Hs01_00243076 predicted 798
9 SASI_Hs01_00243078 predicted 539
10 SASI_Hs02_00339810 predicted 1025
11 SASI_Hs01_00243077 predicted 727
12 SASI_Hs01_00243079 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047870 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206367 predicted 1068
2 SASI_Rn02_00206368 predicted 756
3 SASI_Rn02_00206369 predicted 986
4 SASI_Rn02_00206370 predicted 390
5 SASI_Rn02_00206371 predicted 623
6 SASI_Rn02_00206372 predicted 554
7 SASI_Rn02_00206373 predicted 942
8 SASI_Rn02_00206374 predicted 894
9 SASI_Rn02_00206375 predicted 738
10 SASI_Rn02_00206376 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158169 predicted 570
2 SASI_Mm01_00158170 predicted 829
3 SASI_Mm01_00158171 predicted 1067
4 SASI_Mm01_00158172 predicted 254
5 SASI_Mm01_00158173 predicted 1355
6 SASI_Mm01_00158174 predicted 476
7 SASI_Mm01_00158175 predicted 703
8 SASI_Mm01_00158176 predicted 1273
9 SASI_Mm01_00158177 predicted 1280
10 SASI_Mm01_00158178 predicted 1293
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005556
VALIDATED
KRT7 MISSION shRNA Bacterial Glycerol Stock
keratin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1038s1c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1356s1c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1571s1c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-316s1c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1356s21c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-778s1c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1038s21c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-316s21c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-778s21c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1571s21c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005556
VALIDATED
KRT7 MISSION shRNA shRNA Plasmid DNA
keratin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1038s1c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1356s1c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1571s1c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-316s1c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1356s21c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-778s1c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1038s21c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-316s21c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-778s21c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1571s21c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005556
VALIDATED
KRT7 MISSION shRNA Lentiviral Transduction Particles
keratin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1038s1c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1356s1c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116347    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-1571s1c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-316s1c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1356s21c1
Sequence:CCGGCCGTGAATATCTCTGTGATGACTCGAGTCATCACAGAGATATTCACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_005556.3-778s1c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1038s21c1
Sequence:CCGGCCCGGAATGAGATTTCAGAGACTCGAGTCTCTGAAATCTCATTCCGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-316s21c1
Sequence:CCGGCCGCGAGGTCACCATTAACCACTCGAGTGGTTAATGGTGACCTCGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-778s21c1
Sequence:CCGGCCTGAATGATGAGATCAACTTCTCGAGAAGTTGATCTCATCATTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315722    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005556.3-1571s21c1
Sequence:CCGGACCCACAATCACAAGAAGATTCTCGAGAATCTTCTTGTGATTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033073
VALIDATED
KRT7 MISSION shRNA Bacterial Glycerol Stock
keratin 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-827s21c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-827s1c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1339s1c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033073.2-1461s1c1
Sequence:CCGGATACAACCAAGCTGTGGGCTTCTCGAGAAGCCCACAGCTTGGTTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033073.2-1101s1c1
Sequence:CCGGCAATCAAGGATGCTCATGCTACTCGAGTAGCATGAGCATCCTTGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1051s1c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1051s21c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-988s21c1
Sequence:CCGGTGCGGAGATGAACCGCTCTATCTCGAGATAGAGCGGTTCATCTCCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033073.2-252s21c1
Sequence:CCGGTCCGCGAGATCACCATCAATCCTCGAGGATTGATGGTGATCTCGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1339s21c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033073
VALIDATED
KRT7 MISSION shRNA shRNA Plasmid DNA
keratin 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-827s21c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-827s1c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1339s1c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033073.2-1461s1c1
Sequence:CCGGATACAACCAAGCTGTGGGCTTCTCGAGAAGCCCACAGCTTGGTTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033073.2-1101s1c1
Sequence:CCGGCAATCAAGGATGCTCATGCTACTCGAGTAGCATGAGCATCCTTGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1051s1c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1051s21c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-988s21c1
Sequence:CCGGTGCGGAGATGAACCGCTCTATCTCGAGATAGAGCGGTTCATCTCCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033073.2-252s21c1
Sequence:CCGGTCCGCGAGATCACCATCAATCCTCGAGGATTGATGGTGATCTCGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000324124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1339s21c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033073
VALIDATED
KRT7 MISSION shRNA Lentiviral Transduction Particles
keratin 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-827s21c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-827s1c1
Sequence:CCGGCTGGACTTGGATGGTATCATTCTCGAGAATGATACCATCCAAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1339s1c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089658    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033073.2-1461s1c1
Sequence:CCGGATACAACCAAGCTGTGGGCTTCTCGAGAAGCCCACAGCTTGGTTGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033073.2-1101s1c1
Sequence:CCGGCAATCAAGGATGCTCATGCTACTCGAGTAGCATGAGCATCCTTGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_033073.2-1051s1c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1051s21c1
Sequence:CCGGTGCCAAGTTAGAGTCCAGCATCTCGAGATGCTGGACTCTAACTTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-988s21c1
Sequence:CCGGTGCGGAGATGAACCGCTCTATCTCGAGATAGAGCGGTTCATCTCCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033073.2-252s21c1
Sequence:CCGGTCCGCGAGATCACCATCAATCCTCGAGGATTGATGGTGATCTCGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000324124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_033073.2-1339s21c1
Sequence:CCGGGCTTATCTTCGGAGGAACCATCTCGAGATGGTTCCTCCGAAGATAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)