EMAIL THIS PAGE TO A FRIEND

KRT80

keratin 80

206 Gene Product Result for
Synonyms: KB20
UniProtKB ID: Q6KB66, Q6P1A5, Q7Z3Q0
Gene ID:
Human(144501) Summary: Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene's expression profile shows that it encodes a type II epithelial keratin, although structurally the encoded protein is more like a type II hair keratin. This protein is involved in cell differentiation, localizing near desmosomal plaques in earlier stages of differentiation but then dispersing throughout the cytoplasm in terminally differentiating cells. The type II keratins are clustered in a region of chromosome 12q13. Two transcript variants encoding two different fully functional isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
Mouse(74127) keratin 80
Rat(315318) keratin 80
sheep(101113319) keratin 80
chicken(431302) keratin 80
cow(522400) keratin 80
Horse(100061386) keratin 80
dog(486534) keratin 80
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182507 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182507 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182507 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028770 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028770 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028770 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_283319 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283319 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283319 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081492 Rosetta Predictions human pricing
NM_182507 Rosetta Predictions human pricing
NM_001008815 Rosetta Predictions rat pricing
NM_028770 Rosetta Predictions mouse pricing
XM_283319 Rosetta Predictions mouse pricing
XM_895080 Rosetta Predictions mouse pricing
XM_902578 Rosetta Predictions mouse pricing
XM_902582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081492 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316383 predicted 695
2 SASI_Hs02_00316384 predicted 670
3 SASI_Hs02_00316385 predicted 982
4 SASI_Hs02_00316386 predicted 477
5 SASI_Hs02_00316387 predicted 945
6 SASI_Hs02_00316388 predicted 780
7 SASI_Hs02_00316389 predicted 510
8 SASI_Hs02_00316390 predicted 1028
9 SASI_Hs02_00316391 predicted 1741
10 SASI_Hs02_00316392 predicted 1838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370567 predicted 698
2 SASI_Hs02_00370568 predicted 661
3 SASI_Hs02_00370569 predicted 985
4 SASI_Hs02_00370570 predicted 477
5 SASI_Hs02_00370571 predicted 947
6 SASI_Hs02_00370572 predicted 776
7 SASI_Hs02_00370573 predicted 518
8 SASI_Hs02_00370574 predicted 1033
9 SASI_Hs02_00370575 predicted 1708
10 SASI_Hs02_00370576 predicted 1801
11 SASI_Hs01_00015308 predicted 1107
12 SASI_Hs01_00015309 predicted 1369
13 SASI_Hs01_00015310 predicted 1092
14 SASI_Hs01_00015311 predicted 1563
15 SASI_Hs01_00015312 predicted 493
16 SASI_Hs01_00015313 predicted 506
17 SASI_Hs01_00015314 predicted 1050
18 SASI_Hs01_00015315 predicted 529
19 SASI_Hs01_00015316 predicted 1605
20 SASI_Hs01_00015317 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008815 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053935 predicted 284
2 SASI_Rn01_00053936 predicted 928
3 SASI_Rn02_00199305 predicted 925
4 SASI_Rn01_00053937 predicted 671
5 SASI_Rn01_00053939 predicted 248
6 SASI_Rn02_00199306 predicted 1000
7 SASI_Rn01_00053940 predicted 589
8 SASI_Rn01_00053941 predicted 212
9 SASI_Rn02_00199307 predicted 920
10 SASI_Rn02_00199308 predicted 816
11 SASI_Rn01_00053934 predicted 369
12 SASI_Rn01_00053938 predicted 582
13 SASI_Rn01_00053942 predicted 225
14 SASI_Rn01_00053943 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028770 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00334369 predicted 1436
2 SASI_Mm02_00334370 predicted 556
3 SASI_Mm02_00334371 predicted 742
4 SASI_Mm02_00334372 predicted 994
5 SASI_Mm02_00334373 predicted 276
6 SASI_Mm02_00334374 predicted 362
7 SASI_Mm02_00334375 predicted 1160
8 SASI_Mm02_00334376 predicted 1009
9 SASI_Mm02_00334377 predicted 578
10 SASI_Mm02_00334378 predicted 1460
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_283319 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232992 predicted 1158
2 SASI_Mm01_00232993 predicted 461
3 SASI_Mm01_00232994 predicted 1228
4 SASI_Mm01_00232995 predicted 1387
5 SASI_Mm01_00232996 predicted 359
6 SASI_Mm01_00232997 predicted 531
7 SASI_Mm01_00232998 predicted 1367
8 SASI_Mm01_00232999 predicted 789
9 SASI_Mm01_00233000 predicted 957
10 SASI_Mm01_00233001 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895080 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00259092 predicted 1569
2 SASI_Mm01_00259093 predicted 879
3 SASI_Mm01_00259094 predicted 1650
4 SASI_Mm01_00259095 predicted 1809
5 SASI_Mm01_00259096 predicted 771
6 SASI_Mm01_00259097 predicted 955
7 SASI_Mm01_00259098 predicted 1791
8 SASI_Mm01_00259099 predicted 1215
9 SASI_Mm01_00259100 predicted 1366
10 SASI_Mm01_00259101 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00202700 predicted 1464
2 SASI_Mm01_00202701 predicted 1620
3 SASI_Mm01_00202702 predicted 1257
4 SASI_Mm01_00202703 predicted 1636
5 SASI_Mm01_00202704 predicted 641
6 SASI_Mm01_00202705 predicted 1606
7 SASI_Mm01_00202706 predicted 890
8 SASI_Mm01_00202707 predicted 1666
9 SASI_Mm01_00202708 predicted 1054
10 SASI_Mm01_00202709 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00203046 predicted 777
2 SASI_Mm01_00203047 predicted 1034
3 SASI_Mm01_00203048 predicted 487
4 SASI_Mm01_00203049 predicted 1021
5 SASI_Mm01_00203050 predicted 557
6 SASI_Mm01_00203051 predicted 796
7 SASI_Mm01_00203052 predicted 530
8 SASI_Mm01_00203053 predicted 477
9 SASI_Mm01_00203054 predicted 738
10 SASI_Mm01_00203055 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182507
VALIDATED
KRT80 MISSION shRNA Bacterial Glycerol Stock
keratin 80
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-505s1c1
Sequence:CCGGCTCTCCTTTATGCCCAATCAACTCGAGTTGATTGGGCATAAAGGAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-3241s1c1
Sequence:CCGGCCCTTCCTGTTTCTGCATGATCTCGAGATCATGCAGAAACAGGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-1467s1c1
Sequence:CCGGCGAAATGTCAGAGAAGTACTTCTCGAGAAGTACTTCTCTGACATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-400s1c1
Sequence:CCGGGACATGGAGTTCACCTTTGTTCTCGAGAACAAAGGTGAACTCCATGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-502s1c1
Sequence:CCGGCTACTCTCCTTTATGCCCAATCTCGAGATTGGGCATAAAGGAGAGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1507s21c1
Sequence:CCGGCTTAAGCTAGACTCAAGAAAGCTCGAGCTTTCTTGAGTCTAGCTTAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1715s21c1
Sequence:CCGGCTGATGGGTGAGTCGGAATTACTCGAGTAATTCCGACTCACCCATCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182507.2-483s21c1
Sequence:CCGGGGGCATCTCTATGAGGAATATCTCGAGATATTCCTCATAGAGATGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182507
VALIDATED
KRT80 MISSION shRNA shRNA Plasmid DNA
keratin 80
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-505s1c1
Sequence:CCGGCTCTCCTTTATGCCCAATCAACTCGAGTTGATTGGGCATAAAGGAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-3241s1c1
Sequence:CCGGCCCTTCCTGTTTCTGCATGATCTCGAGATCATGCAGAAACAGGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-1467s1c1
Sequence:CCGGCGAAATGTCAGAGAAGTACTTCTCGAGAAGTACTTCTCTGACATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-400s1c1
Sequence:CCGGGACATGGAGTTCACCTTTGTTCTCGAGAACAAAGGTGAACTCCATGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-502s1c1
Sequence:CCGGCTACTCTCCTTTATGCCCAATCTCGAGATTGGGCATAAAGGAGAGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1507s21c1
Sequence:CCGGCTTAAGCTAGACTCAAGAAAGCTCGAGCTTTCTTGAGTCTAGCTTAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1715s21c1
Sequence:CCGGCTGATGGGTGAGTCGGAATTACTCGAGTAATTCCGACTCACCCATCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182507.2-483s21c1
Sequence:CCGGGGGCATCTCTATGAGGAATATCTCGAGATATTCCTCATAGAGATGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182507
VALIDATED
KRT80 MISSION shRNA Lentiviral Transduction Particles
keratin 80
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-505s1c1
Sequence:CCGGCTCTCCTTTATGCCCAATCAACTCGAGTTGATTGGGCATAAAGGAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-3241s1c1
Sequence:CCGGCCCTTCCTGTTTCTGCATGATCTCGAGATCATGCAGAAACAGGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-1467s1c1
Sequence:CCGGCGAAATGTCAGAGAAGTACTTCTCGAGAAGTACTTCTCTGACATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_182507.1-400s1c1
Sequence:CCGGGACATGGAGTTCACCTTTGTTCTCGAGAACAAAGGTGAACTCCATGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182507.1-502s1c1
Sequence:CCGGCTACTCTCCTTTATGCCCAATCTCGAGATTGGGCATAAAGGAGAGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425392    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1507s21c1
Sequence:CCGGCTTAAGCTAGACTCAAGAAAGCTCGAGCTTTCTTGAGTCTAGCTTAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416750    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182507.2-1715s21c1
Sequence:CCGGCTGATGGGTGAGTCGGAATTACTCGAGTAATTCCGACTCACCCATCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182507.2-483s21c1
Sequence:CCGGGGGCATCTCTATGAGGAATATCTCGAGATATTCCTCATAGAGATGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028770
VALIDATED
KRT80 MISSION shRNA Bacterial Glycerol Stock
keratin 80
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028770.2-331s21c1
Sequence:CCGGTGAAGGCTCTCAATGATAAATCTCGAGATTTATCATTGAGAGCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028770.2-1461s21c1
Sequence:CCGGCTTCCACTGCAGCCGACTTAACTCGAGTTAAGTCGGCTGCAGTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-448s21c1
Sequence:CCGGTCGACCTCAGCCACCATTATGCTCGAGCATAATGGTGGCTGAGGTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-1160s21c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-611s21c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028770
VALIDATED
KRT80 MISSION shRNA shRNA Plasmid DNA
keratin 80
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028770.2-331s21c1
Sequence:CCGGTGAAGGCTCTCAATGATAAATCTCGAGATTTATCATTGAGAGCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028770.2-1461s21c1
Sequence:CCGGCTTCCACTGCAGCCGACTTAACTCGAGTTAAGTCGGCTGCAGTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-448s21c1
Sequence:CCGGTCGACCTCAGCCACCATTATGCTCGAGCATAATGGTGGCTGAGGTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-1160s21c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-611s21c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028770
VALIDATED
KRT80 MISSION shRNA Lentiviral Transduction Particles
keratin 80
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_028770.2-331s21c1
Sequence:CCGGTGAAGGCTCTCAATGATAAATCTCGAGATTTATCATTGAGAGCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313207    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028770.2-1461s21c1
Sequence:CCGGCTTCCACTGCAGCCGACTTAACTCGAGTTAAGTCGGCTGCAGTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-448s21c1
Sequence:CCGGTCGACCTCAGCCACCATTATGCTCGAGCATAATGGTGGCTGAGGTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-1160s21c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028770.2-611s21c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283319
VALIDATED
KRT80 MISSION shRNA Bacterial Glycerol Stock
keratin 80
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-2416s1c1
Sequence:CCGGCCTGGGAAGATCTGGAAGTTTCTCGAGAAACTTCCAGATCTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-650s1c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-1199s1c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-534s1c1
Sequence:CCGGGAGCTTCGTAAAGTGAGCCAACTCGAGTTGGCTCACTTTACGAAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283319.4-1431s1c1
Sequence:CCGGGAGAAATATCTCTCCCAGGAACTCGAGTTCCTGGGAGAGATATTTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283319
VALIDATED
KRT80 MISSION shRNA shRNA Plasmid DNA
keratin 80
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-2416s1c1
Sequence:CCGGCCTGGGAAGATCTGGAAGTTTCTCGAGAAACTTCCAGATCTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-650s1c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-1199s1c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-534s1c1
Sequence:CCGGGAGCTTCGTAAAGTGAGCCAACTCGAGTTGGCTCACTTTACGAAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283319.4-1431s1c1
Sequence:CCGGGAGAAATATCTCTCCCAGGAACTCGAGTTCCTGGGAGAGATATTTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283319
VALIDATED
KRT80 MISSION shRNA Lentiviral Transduction Particles
keratin 80
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091683    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-2416s1c1
Sequence:CCGGCCTGGGAAGATCTGGAAGTTTCTCGAGAAACTTCCAGATCTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-650s1c1
Sequence:CCGGCCTGGAGTTTACCTTTGTCCACTCGAGTGGACAAAGGTAAACTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-1199s1c1
Sequence:CCGGGCGCGAGTATCAGGATCTCATCTCGAGATGAGATCCTGATACTCGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:XM_283319.4-534s1c1
Sequence:CCGGGAGCTTCGTAAAGTGAGCCAACTCGAGTTGGCTCACTTTACGAAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283319.4-1431s1c1
Sequence:CCGGGAGAAATATCTCTCCCAGGAACTCGAGTTCCTGGGAGAGATATTTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)