EMAIL THIS PAGE TO A FRIEND

KRT81

keratin 81

33 Gene Product Result for
Synonyms: HB1 Hb-1 KRTHB1 MLN137 ghHkb1 hHAKB2-1
UniProtKB ID: Q14533, Q14846, Q16274, Q17R48, Q8WU52, Q9BR74
Gene ID:
Human(3887) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB3 and KRTHB6, is found primarily in the hair cortex. Mutations in this gene and KRTHB6 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]
Mouse(64818) keratin 81
Rat(407761) keratin 81
cow(540204) keratin 81
dog(486531) keratin 81
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_354889 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_354889 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_354889 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002281 Rosetta Predictions human pricing
NM_001008814 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136645 predicted 1654
2 SASI_Hs02_00333569 predicted 788
3 SASI_Hs01_00136648 predicted 1644
4 SASI_Hs01_00136646 predicted 884
5 SASI_Hs01_00136647 predicted 1287
6 SASI_Hs01_00136649 predicted 1659
7 SASI_Hs01_00136652 predicted 1747
8 SASI_Hs01_00136653 predicted 1868
9 SASI_Hs01_00136650 predicted 1652
10 SASI_Hs01_00136651 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008814 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110474 predicted 1397
2 SASI_Rn01_00110475 predicted 1241
3 SASI_Rn01_00110476 predicted 1371
4 SASI_Rn01_00110477 predicted 1306
5 SASI_Rn01_00110478 predicted 1415
6 SASI_Rn01_00110479 predicted 1424
7 SASI_Rn01_00110480 predicted 7
8 SASI_Rn01_00110481 predicted 1481
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002281
KRT81 MISSION shRNA Bacterial Glycerol Stock
keratin 81
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-791s21c1
Sequence:CCGGCCTCATTCTCCAGTCGCACATCTCGAGATGTGCGACTGGAGAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1646s21c1
Sequence:CCGGAGCAAGTGCTCAGCTACTTCTCTCGAGAGAAGTAGCTGAGCACTTGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-1504s21c1
Sequence:CCCGTGGGCTCCTGTGGTATCAGCTCTCGAGAGCTGATACCACAGGAGCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1690s21c1
Sequence:CCGGCACTCCTGGCCTCACATTTCTCTCGAGAGAAATGTGAGGCCAGGAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002281.2-1698s1c1
Sequence:CCGGCCTCACATTTCTCTGTGTGATCTCGAGATCACACAGAGAAATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-647s1c1
Sequence:CCGGTCTGAGAGCAACAGCTGAGAACTCGAGTTCTCAGCTGTTGCTCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-865s1c1
Sequence:CCGGACTGCATCATTGCCGAGATTACTCGAGTAATCTCGGCAATGATGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-1462s1c1
Sequence:CCGGGCGGCCAATTGAACACCACCTCTCGAGAGGTGGTGTTCAATTGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-876s1c1
Sequence:CCGGGCCGAGATTAAGGCACAGTATCTCGAGATACTGTGCCTTAATCTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002281
KRT81 MISSION shRNA shRNA Plasmid DNA
keratin 81
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-791s21c1
Sequence:CCGGCCTCATTCTCCAGTCGCACATCTCGAGATGTGCGACTGGAGAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1646s21c1
Sequence:CCGGAGCAAGTGCTCAGCTACTTCTCTCGAGAGAAGTAGCTGAGCACTTGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-1504s21c1
Sequence:CCCGTGGGCTCCTGTGGTATCAGCTCTCGAGAGCTGATACCACAGGAGCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1690s21c1
Sequence:CCGGCACTCCTGGCCTCACATTTCTCTCGAGAGAAATGTGAGGCCAGGAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002281.2-1698s1c1
Sequence:CCGGCCTCACATTTCTCTGTGTGATCTCGAGATCACACAGAGAAATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-647s1c1
Sequence:CCGGTCTGAGAGCAACAGCTGAGAACTCGAGTTCTCAGCTGTTGCTCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-865s1c1
Sequence:CCGGACTGCATCATTGCCGAGATTACTCGAGTAATCTCGGCAATGATGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-1462s1c1
Sequence:CCGGGCGGCCAATTGAACACCACCTCTCGAGAGGTGGTGTTCAATTGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-876s1c1
Sequence:CCGGGCCGAGATTAAGGCACAGTATCTCGAGATACTGTGCCTTAATCTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002281
KRT81 MISSION shRNA Lentiviral Transduction Particles
keratin 81
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-791s21c1
Sequence:CCGGCCTCATTCTCCAGTCGCACATCTCGAGATGTGCGACTGGAGAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417307    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1646s21c1
Sequence:CCGGAGCAAGTGCTCAGCTACTTCTCTCGAGAGAAGTAGCTGAGCACTTGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002281.3-1504s21c1
Sequence:CCCGTGGGCTCCTGTGGTATCAGCTCTCGAGAGCTGATACCACAGGAGCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437144    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002281.3-1690s21c1
Sequence:CCGGCACTCCTGGCCTCACATTTCTCTCGAGAGAAATGTGAGGCCAGGAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117212    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002281.2-1698s1c1
Sequence:CCGGCCTCACATTTCTCTGTGTGATCTCGAGATCACACAGAGAAATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-647s1c1
Sequence:CCGGTCTGAGAGCAACAGCTGAGAACTCGAGTTCTCAGCTGTTGCTCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-865s1c1
Sequence:CCGGACTGCATCATTGCCGAGATTACTCGAGTAATCTCGGCAATGATGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-1462s1c1
Sequence:CCGGGCGGCCAATTGAACACCACCTCTCGAGAGGTGGTGTTCAATTGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002281.2-876s1c1
Sequence:CCGGGCCGAGATTAAGGCACAGTATCTCGAGATACTGTGCCTTAATCTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_354889
KRT81 MISSION shRNA Bacterial Glycerol Stock
keratin 81
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-820s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-598s1c1
Sequence:CCGGGCCACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-303s1c1
Sequence:CCGGGCATGAGGAGAAAGAGCAGATCTCGAGATCTGCTCTTTCTCCTCATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-702s1c1
Sequence:CCGGCGACTTCCTGAGGAGAATGTACTCGAGTACATTCTCCTCAGGAAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-1283s1c1
Sequence:CCGGGCTCCCGAGGAGGAGTCGTATCTCGAGATACGACTCCTCCTCGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_354889
KRT81 MISSION shRNA shRNA Plasmid DNA
keratin 81
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-820s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-598s1c1
Sequence:CCGGGCCACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-303s1c1
Sequence:CCGGGCATGAGGAGAAAGAGCAGATCTCGAGATCTGCTCTTTCTCCTCATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-702s1c1
Sequence:CCGGCGACTTCCTGAGGAGAATGTACTCGAGTACATTCTCCTCAGGAAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-1283s1c1
Sequence:CCGGGCTCCCGAGGAGGAGTCGTATCTCGAGATACGACTCCTCCTCGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_354889
KRT81 MISSION shRNA Lentiviral Transduction Particles
keratin 81
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-820s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-598s1c1
Sequence:CCGGGCCACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-303s1c1
Sequence:CCGGGCATGAGGAGAAAGAGCAGATCTCGAGATCTGCTCTTTCTCCTCATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-702s1c1
Sequence:CCGGCGACTTCCTGAGGAGAATGTACTCGAGTACATTCTCCTCAGGAAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_354889.3-1283s1c1
Sequence:CCGGGCTCCCGAGGAGGAGTCGTATCTCGAGATACGACTCCTCCTCGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)