EMAIL THIS PAGE TO A FRIEND

KRT84

keratin 84

55 Gene Product Result for
Synonyms: HB4 KRTHB4
UniProtKB ID: Q9NSB2, B2RA43, Q6ISB0, Q701L6
Gene ID:
Human(3890) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin is contained primarily in the filiform tongue papilla, among other hair keratins. [provided by RefSeq, Jul 2008]
Mouse(16680) keratin 84
Rat(315320) keratin 84
dog(486526) keratin 84
cow(539944) keratin 84
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008474 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008474 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008474 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033045 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU025491 MISSION® esiRNA esiRNA targeting mouse Krt84 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033045 Rosetta Predictions human pricing
NM_001008812 Rosetta Predictions rat pricing
NM_008474 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224444 predicted 1152
2 SASI_Hs01_00224445 predicted 802
3 SASI_Hs01_00224446 predicted 446
4 SASI_Hs01_00224447 predicted 350
5 SASI_Hs01_00224448 predicted 1491
6 SASI_Hs01_00224449 predicted 920
7 SASI_Hs01_00224451 predicted 467
8 SASI_Hs01_00224452 predicted 201
9 SASI_Hs02_00360732 predicted 875
10 SASI_Hs02_00360733 predicted 1028
11 SASI_Hs01_00224443 predicted 1177
12 SASI_Hs01_00224450 predicted 395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118625 predicted 1158
2 SASI_Rn01_00118626 predicted 441
3 SASI_Rn02_00199303 predicted 824
4 SASI_Rn01_00118627 predicted 863
5 SASI_Rn01_00118628 predicted 778
6 SASI_Rn01_00118629 predicted 1154
7 SASI_Rn02_00199304 predicted 979
8 SASI_Rn01_00118630 predicted 278
9 SASI_Rn01_00118631 predicted 978
10 SASI_Rn01_00118633 predicted 948
11 SASI_Rn01_00118624 predicted 654
12 SASI_Rn01_00118632 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008474 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104672 predicted 450
2 SASI_Mm02_00313985 predicted 1854
3 SASI_Mm01_00104675 predicted 873
4 SASI_Mm01_00104676 predicted 924
5 SASI_Mm01_00104677 predicted 1540
6 SASI_Mm02_00313986 predicted 1484
7 SASI_Mm01_00104678 predicted 1198
8 SASI_Mm01_00104679 predicted 987
9 SASI_Mm01_00104680 predicted 1222
10 SASI_Mm01_00104681 predicted 651
11 SASI_Mm01_00104673 predicted 803
12 SASI_Mm01_00104674 predicted 969
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008474
KRT84 MISSION shRNA Bacterial Glycerol Stock
keratin 84
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008474.1-1971s1c1
Sequence:CCGGCCTCCTGAAGATTCTCCTAATCTCGAGATTAGGAGAATCTTCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-183s1c1
Sequence:CCGGGCGTCATCAACTTTGGATCATCTCGAGATGATCCAAAGTTGATGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-875s1c1
Sequence:CCGGGCTTTCCTGAACAAATCTGATCTCGAGATCAGATTTGTTCAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-1202s1c1
Sequence:CCGGCGGTTGATCCAGAGGCTGAAACTCGAGTTTCAGCCTCTGGATCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-679s1c1
Sequence:CCGGGCCTCTCTTCGATAACTATATCTCGAGATATAGTTATCGAAGAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008474
KRT84 MISSION shRNA shRNA Plasmid DNA
keratin 84
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008474.1-1971s1c1
Sequence:CCGGCCTCCTGAAGATTCTCCTAATCTCGAGATTAGGAGAATCTTCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-183s1c1
Sequence:CCGGGCGTCATCAACTTTGGATCATCTCGAGATGATCCAAAGTTGATGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-875s1c1
Sequence:CCGGGCTTTCCTGAACAAATCTGATCTCGAGATCAGATTTGTTCAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-1202s1c1
Sequence:CCGGCGGTTGATCCAGAGGCTGAAACTCGAGTTTCAGCCTCTGGATCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-679s1c1
Sequence:CCGGGCCTCTCTTCGATAACTATATCTCGAGATATAGTTATCGAAGAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008474
KRT84 MISSION shRNA Lentiviral Transduction Particles
keratin 84
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089668    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008474.1-1971s1c1
Sequence:CCGGCCTCCTGAAGATTCTCCTAATCTCGAGATTAGGAGAATCTTCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-183s1c1
Sequence:CCGGGCGTCATCAACTTTGGATCATCTCGAGATGATCCAAAGTTGATGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-875s1c1
Sequence:CCGGGCTTTCCTGAACAAATCTGATCTCGAGATCAGATTTGTTCAGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-1202s1c1
Sequence:CCGGCGGTTGATCCAGAGGCTGAAACTCGAGTTTCAGCCTCTGGATCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008474.1-679s1c1
Sequence:CCGGGCCTCTCTTCGATAACTATATCTCGAGATATAGTTATCGAAGAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033045
KRT84 MISSION shRNA Bacterial Glycerol Stock
keratin 84
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-877s1c1
Sequence:CCGGGCTTTCATGAACAAGTCTGATCTCGAGATCAGACTTGTTCATGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033045.2-2081s1c1
Sequence:CCGGGCCTCCCAATTTCTGTCCTTTCTCGAGAAAGGACAGAAATTGGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-1029s1c1
Sequence:CCGGCCTGAACCTTGATGGGATCATCTCGAGATGATCCCATCAAGGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-654s1c1
Sequence:CCGGGCAGAAATGTATCAGGAGCAACTCGAGTTGCTCCTGATACATTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-911s1c1
Sequence:CCGGTGGATACCCTAACTCAGGAAACTCGAGTTTCCTGAGTTAGGGTATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-814s21c1
Sequence:CCGGGAAGTGGTATGTCGGGCCAATCTCGAGATTGGCCCGACATACCACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-116s21c1
Sequence:CCGGTGACACCACAGAACCTGAATCCTCGAGGATTCAGGTTCTGTGGTGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-1170s21c1
Sequence:CCGGGCGCAACATACGGAACGAGATCTCGAGATCTCGTTCCGTATGTTGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033045
KRT84 MISSION shRNA shRNA Plasmid DNA
keratin 84
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-877s1c1
Sequence:CCGGGCTTTCATGAACAAGTCTGATCTCGAGATCAGACTTGTTCATGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033045.2-2081s1c1
Sequence:CCGGGCCTCCCAATTTCTGTCCTTTCTCGAGAAAGGACAGAAATTGGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-1029s1c1
Sequence:CCGGCCTGAACCTTGATGGGATCATCTCGAGATGATCCCATCAAGGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-654s1c1
Sequence:CCGGGCAGAAATGTATCAGGAGCAACTCGAGTTGCTCCTGATACATTTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-911s1c1
Sequence:CCGGTGGATACCCTAACTCAGGAAACTCGAGTTTCCTGAGTTAGGGTATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000445527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-814s21c1
Sequence:CCGGGAAGTGGTATGTCGGGCCAATCTCGAGATTGGCCCGACATACCACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-116s21c1
Sequence:CCGGTGACACCACAGAACCTGAATCCTCGAGGATTCAGGTTCTGTGGTGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-1170s21c1
Sequence:CCGGGCGCAACATACGGAACGAGATCTCGAGATCTCGTTCCGTATGTTGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033045
KRT84 MISSION shRNA Lentiviral Transduction Particles
keratin 84
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116984    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-877s1c1
Sequence:CCGGGCTTTCATGAACAAGTCTGATCTCGAGATCAGACTTGTTCATGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_033045.2-2081s1c1
Sequence:CCGGGCCTCCCAATTTCTGTCCTTTCTCGAGAAAGGACAGAAATTGGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-1029s1c1
Sequence:CCGGCCTGAACCTTGATGGGATCATCTCGAGATGATCCCATCAAGGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-654s1c1
Sequence:CCGGGCAGAAATGTATCAGGAGCAACTCGAGTTGCTCCTGATACATTTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033045.2-911s1c1
Sequence:CCGGTGGATACCCTAACTCAGGAAACTCGAGTTTCCTGAGTTAGGGTATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000445527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-814s21c1
Sequence:CCGGGAAGTGGTATGTCGGGCCAATCTCGAGATTGGCCCGACATACCACTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-116s21c1
Sequence:CCGGTGACACCACAGAACCTGAATCCTCGAGGATTCAGGTTCTGTGGTGTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033045.3-1170s21c1
Sequence:CCGGGCGCAACATACGGAACGAGATCTCGAGATCTCGTTCCGTATGTTGCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)