EMAIL THIS PAGE TO A FRIEND

KRT85

keratin 85

48 Gene Product Result for
Synonyms: ECTD4 HB5 Hb-5 KRTHB5 hHb5
UniProtKB ID: P78386, Q9NSB1
Gene ID:
Human(3891) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. [provided by RefSeq, Jul 2008]
Mouse(53622) keratin 85
Rat(407762) keratin 85
cow(528459) keratin 85
cow(523073) keratin 85
dog(486527) keratin 85
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002283 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002283 Rosetta Predictions human pricing
NM_001008811 Rosetta Predictions rat pricing
NM_016879 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059008 predicted 1425
2 SASI_Hs01_00059010 predicted 569
3 SASI_Hs01_00059011 predicted 1969
4 SASI_Hs01_00059012 predicted 1419
5 SASI_Hs01_00059013 predicted 570
6 SASI_Hs01_00059014 predicted 1407
7 SASI_Hs01_00059015 predicted 1531
8 SASI_Hs01_00059016 predicted 1748
9 SASI_Hs01_00059017 predicted 923
10 SASI_Hs02_00333571 predicted 934
11 SASI_Hs01_00059009 predicted 2123
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00033441 predicted 639
2 SASI_Rn01_00033442 predicted 776
3 SASI_Rn01_00033446 predicted 753
4 SASI_Rn01_00033449 predicted 750
5 SASI_Rn01_00033447 predicted 488
6 SASI_Rn01_00033448 predicted 700
7 SASI_Rn01_00033450 predicted 30
8 SASI_Rn02_00199302 predicted 74
9 SASI_Rn01_00033443 predicted 1091
10 SASI_Rn01_00033444 predicted 1065
11 SASI_Rn01_00033445 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162340 predicted 1812
2 SASI_Mm01_00162341 predicted 1683
3 SASI_Mm01_00162342 predicted 620
4 SASI_Mm01_00162346 predicted 1822
5 SASI_Mm01_00162343 predicted 825
6 SASI_Mm01_00162344 predicted 1594
7 SASI_Mm01_00162345 predicted 738
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002283
KRT85 MISSION shRNA Bacterial Glycerol Stock
keratin 85
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002283.3-818s21c1
Sequence:CCGGACTGTGCCTACCTGCGGAAATCTCGAGATTTCCGCAGGTAGGCACAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-2036s21c1
Sequence:CCGGACCCGAGAATCAGGGAGAAAGCTCGAGCTTTCTCCCTGATTCTCGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-1723s21c1
Sequence:CCGGTGTGTGCTTGCTTCCAGAATCCTCGAGGATTCTGGAAGCAAGCACACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002283.2-1874s1c1
Sequence:CCGGCCCTTCACTTAACTCCTACTTCTCGAGAAGTAGGAGTTAAGTGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-784s1c1
Sequence:CCGGGAGAATGAGTTTGTCGTTCTACTCGAGTAGAACGACAAACTCATTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-627s1c1
Sequence:CCGGGCCACTGTTCAGTGGCTACATCTCGAGATGTAGCCACTGAACAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-939s1c1
Sequence:CCGGCACCTCGGTCATAGTCAAGATCTCGAGATCTTGACTATGACCGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-785s1c1
Sequence:CCGGAGAATGAGTTTGTCGTTCTAACTCGAGTTAGAACGACAAACTCATTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002283
KRT85 MISSION shRNA shRNA Plasmid DNA
keratin 85
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002283.3-818s21c1
Sequence:CCGGACTGTGCCTACCTGCGGAAATCTCGAGATTTCCGCAGGTAGGCACAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-2036s21c1
Sequence:CCGGACCCGAGAATCAGGGAGAAAGCTCGAGCTTTCTCCCTGATTCTCGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-1723s21c1
Sequence:CCGGTGTGTGCTTGCTTCCAGAATCCTCGAGGATTCTGGAAGCAAGCACACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002283.2-1874s1c1
Sequence:CCGGCCCTTCACTTAACTCCTACTTCTCGAGAAGTAGGAGTTAAGTGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-784s1c1
Sequence:CCGGGAGAATGAGTTTGTCGTTCTACTCGAGTAGAACGACAAACTCATTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-627s1c1
Sequence:CCGGGCCACTGTTCAGTGGCTACATCTCGAGATGTAGCCACTGAACAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-939s1c1
Sequence:CCGGCACCTCGGTCATAGTCAAGATCTCGAGATCTTGACTATGACCGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-785s1c1
Sequence:CCGGAGAATGAGTTTGTCGTTCTAACTCGAGTTAGAACGACAAACTCATTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002283
KRT85 MISSION shRNA Lentiviral Transduction Particles
keratin 85
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434170    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002283.3-818s21c1
Sequence:CCGGACTGTGCCTACCTGCGGAAATCTCGAGATTTCCGCAGGTAGGCACAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417268    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-2036s21c1
Sequence:CCGGACCCGAGAATCAGGGAGAAAGCTCGAGCTTTCTCCCTGATTCTCGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002283.3-1723s21c1
Sequence:CCGGTGTGTGCTTGCTTCCAGAATCCTCGAGGATTCTGGAAGCAAGCACACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113911    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002283.2-1874s1c1
Sequence:CCGGCCCTTCACTTAACTCCTACTTCTCGAGAAGTAGGAGTTAAGTGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-784s1c1
Sequence:CCGGGAGAATGAGTTTGTCGTTCTACTCGAGTAGAACGACAAACTCATTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-627s1c1
Sequence:CCGGGCCACTGTTCAGTGGCTACATCTCGAGATGTAGCCACTGAACAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-939s1c1
Sequence:CCGGCACCTCGGTCATAGTCAAGATCTCGAGATCTTGACTATGACCGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002283.2-785s1c1
Sequence:CCGGAGAATGAGTTTGTCGTTCTAACTCGAGTTAGAACGACAAACTCATTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016879
KRT85 MISSION shRNA Bacterial Glycerol Stock
keratin 85
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000217066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016879.2-1677s1c1
Sequence:CCGGCCAGAATCTTCCAGATGTTTCCTCGAGGAAACATCTGGAAGATTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016879.2-1295s1c1
Sequence:CCGGCCAGGAGGTAATGAACTCCAACTCGAGTTGGAGTTCATTACCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-954s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-738s1c1
Sequence:CCGGGCAGAGAATGAGTTTGTGGTACTCGAGTACCACAAACTCATTCTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-774s1c1
Sequence:CCGGGACTGTGCCTACTTACGTAAACTCGAGTTTACGTAAGTAGGCACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-732s1c1
Sequence:CCGGGCTACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016879
KRT85 MISSION shRNA shRNA Plasmid DNA
keratin 85
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000217066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016879.2-1677s1c1
Sequence:CCGGCCAGAATCTTCCAGATGTTTCCTCGAGGAAACATCTGGAAGATTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016879.2-1295s1c1
Sequence:CCGGCCAGGAGGTAATGAACTCCAACTCGAGTTGGAGTTCATTACCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-954s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-738s1c1
Sequence:CCGGGCAGAGAATGAGTTTGTGGTACTCGAGTACCACAAACTCATTCTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-774s1c1
Sequence:CCGGGACTGTGCCTACTTACGTAAACTCGAGTTTACGTAAGTAGGCACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-732s1c1
Sequence:CCGGGCTACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016879
KRT85 MISSION shRNA Lentiviral Transduction Particles
keratin 85
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000217066    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016879.2-1677s1c1
Sequence:CCGGCCAGAATCTTCCAGATGTTTCCTCGAGGAAACATCTGGAAGATTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200125    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016879.2-1295s1c1
Sequence:CCGGCCAGGAGGTAATGAACTCCAACTCGAGTTGGAGTTCATTACCTCCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182292    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-954s1c1
Sequence:CCGGGCTGAGATCAAGGCTCAGTATCTCGAGATACTGAGCCTTGATCTCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-738s1c1
Sequence:CCGGGCAGAGAATGAGTTTGTGGTACTCGAGTACCACAAACTCATTCTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-774s1c1
Sequence:CCGGGACTGTGCCTACTTACGTAAACTCGAGTTTACGTAAGTAGGCACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016879.2-732s1c1
Sequence:CCGGGCTACAGCAGAGAATGAGTTTCTCGAGAAACTCATTCTCTGCTGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)