EMAIL THIS PAGE TO A FRIEND

KRT86

keratin 86

38 Gene Product Result for
Synonyms: HB6 Hb1 KRTHB1 KRTHB6 MNX hHb6
UniProtKB ID: O43790, P78387
Gene ID:
Human(3892) Summary: The protein encoded by this gene is a member of the keratin gene family. As a type II hair keratin, it is a basic protein which heterodimerizes with type I keratins to form hair and nails. The type II hair keratins are clustered in a region of chromosome 12q13 and are grouped into two distinct subfamilies based on structure similarity. One subfamily, consisting of KRTHB1, KRTHB3, and KRTHB6, is highly related. The other less-related subfamily includes KRTHB2, KRTHB4, and KRTHB5. All hair keratins are expressed in the hair follicle; this hair keratin, as well as KRTHB1 and KRTHB3, is found primarily in the hair cortex. Mutations in this gene and KRTHB1 have been observed in patients with a rare dominant hair disease, monilethrix. [provided by RefSeq, Jul 2008]
Mouse(16679) keratin 86
Rat(407760) keratin 86
sheep(101112469) keratin 86
Horse(100062959) keratin 86
dog(486530) keratin 86
cow(535232) keratin 86
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_193809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_193809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_193809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002284 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127411 MISSION® esiRNA esiRNA human KRT86 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002284 Rosetta Predictions human pricing
NM_001008810 Rosetta Predictions rat pricing
NM_010667 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105657 predicted 1366
2 SASI_Hs01_00105659 predicted 885
3 SASI_Hs01_00105658 predicted 795
4 SASI_Hs01_00105660 predicted 1876
5 SASI_Hs01_00105661 predicted 1915
6 SASI_Hs01_00105662 predicted 1717
7 SASI_Hs01_00105663 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082397 predicted 682
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010667 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078466 predicted 1631
2 SASI_Mm02_00319092 predicted 987
3 SASI_Mm02_00319093 predicted 975
4 SASI_Mm01_00078467 predicted 1693
5 SASI_Mm01_00078468 predicted 1684
6 SASI_Mm01_00078469 predicted 1627
7 SASI_Mm01_00078470 predicted 1387
8 SASI_Mm02_00319094 predicted 1125
9 SASI_Mm01_00078465 predicted 1533
10 SASI_Mm01_00078471 predicted 655
11 SASI_Mm01_00078472 predicted 664
12 SASI_Mm01_00078473 predicted 1749
13 SASI_Mm01_00078474 predicted 1835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_193809
KRT86 MISSION shRNA Bacterial Glycerol Stock
keratin 86
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-587s1c1
Sequence:CCGGAGGAAGTTTCTCTGAGAGCTACTCGAGTAGCTCTCAGAGAAACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-330s1c1
Sequence:CCGGCAAGTGTCTCAACAGCAAGTTCTCGAGAACTTGCTGTTGAGACACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-949s1c1
Sequence:CCGGCGCACCAGAGAGGAGATCAATCTCGAGATTGATCTCCTCTCTGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-893s1c1
Sequence:CCGGGCACCAAGTGTGAGGAGATAACTCGAGTTATCTCCTCACACTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-1253s1c1
Sequence:CCGGGCTCCGTGAATGTGTGTGTGACTCGAGTCACACACACATTCACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_193809
KRT86 MISSION shRNA shRNA Plasmid DNA
keratin 86
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-587s1c1
Sequence:CCGGAGGAAGTTTCTCTGAGAGCTACTCGAGTAGCTCTCAGAGAAACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-330s1c1
Sequence:CCGGCAAGTGTCTCAACAGCAAGTTCTCGAGAACTTGCTGTTGAGACACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-949s1c1
Sequence:CCGGCGCACCAGAGAGGAGATCAATCTCGAGATTGATCTCCTCTCTGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-893s1c1
Sequence:CCGGGCACCAAGTGTGAGGAGATAACTCGAGTTATCTCCTCACACTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-1253s1c1
Sequence:CCGGGCTCCGTGAATGTGTGTGTGACTCGAGTCACACACACATTCACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_193809
KRT86 MISSION shRNA Lentiviral Transduction Particles
keratin 86
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-587s1c1
Sequence:CCGGAGGAAGTTTCTCTGAGAGCTACTCGAGTAGCTCTCAGAGAAACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-330s1c1
Sequence:CCGGCAAGTGTCTCAACAGCAAGTTCTCGAGAACTTGCTGTTGAGACACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-949s1c1
Sequence:CCGGCGCACCAGAGAGGAGATCAATCTCGAGATTGATCTCCTCTCTGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-893s1c1
Sequence:CCGGGCACCAAGTGTGAGGAGATAACTCGAGTTATCTCCTCACACTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_193809.4-1253s1c1
Sequence:CCGGGCTCCGTGAATGTGTGTGTGACTCGAGTCACACACACATTCACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002284
KRT86 MISSION shRNA Bacterial Glycerol Stock
keratin 86
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002284.2-1737s1c1
Sequence:CCGGCAATTTGTTGTCCCGAGGATTCTCGAGAATCCTCGGGACAACAAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-670s1c1
Sequence:CCGGCGAGTTTGTGGCTCTGAAGAACTCGAGTTCTTCAGAGCCACAAACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-943s1c1
Sequence:CCGGCCGCAGCAAGTGTGAGGAGATCTCGAGATCTCCTCACACTTGCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-856s1c1
Sequence:CCGGCCTGAACATGGACTGCATCATCTCGAGATGATGCAGTCCATGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-1492s1c1
Sequence:CCGGCGGCAGCTGTAAGAGGTGCTACTCGAGTAGCACCTCTTACAGCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002284
KRT86 MISSION shRNA shRNA Plasmid DNA
keratin 86
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002284.2-1737s1c1
Sequence:CCGGCAATTTGTTGTCCCGAGGATTCTCGAGAATCCTCGGGACAACAAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-670s1c1
Sequence:CCGGCGAGTTTGTGGCTCTGAAGAACTCGAGTTCTTCAGAGCCACAAACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-943s1c1
Sequence:CCGGCCGCAGCAAGTGTGAGGAGATCTCGAGATCTCCTCACACTTGCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-856s1c1
Sequence:CCGGCCTGAACATGGACTGCATCATCTCGAGATGATGCAGTCCATGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-1492s1c1
Sequence:CCGGCGGCAGCTGTAAGAGGTGCTACTCGAGTAGCACCTCTTACAGCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002284
KRT86 MISSION shRNA Lentiviral Transduction Particles
keratin 86
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002284.2-1737s1c1
Sequence:CCGGCAATTTGTTGTCCCGAGGATTCTCGAGAATCCTCGGGACAACAAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-670s1c1
Sequence:CCGGCGAGTTTGTGGCTCTGAAGAACTCGAGTTCTTCAGAGCCACAAACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-943s1c1
Sequence:CCGGCCGCAGCAAGTGTGAGGAGATCTCGAGATCTCCTCACACTTGCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-856s1c1
Sequence:CCGGCCTGAACATGGACTGCATCATCTCGAGATGATGCAGTCCATGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002284.2-1492s1c1
Sequence:CCGGCGGCAGCTGTAAGAGGTGCTACTCGAGTAGCACCTCTTACAGCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)