EMAIL THIS PAGE TO A FRIEND

KRT8

keratin 8

91 Gene Product Result for
Synonyms: CARD2 CK-8 CK8 CYK8 K2C8 K8 KO
Gene ID:
Human(3856) Summary: This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. The product of this gene typically dimerizes with keratin 18 to form an intermediate filament in simple single-layered epithelial cells. This protein plays a role in maintaining cellular structural integrity and also functions in signal transduction and cellular differentiation. Mutations in this gene cause cryptogenic cirrhosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(16691) keratin 8
Rat(25626) keratin 8
Zebrafish(797433) keratin 8
chicken(426896) keratin 8
cow(281269) keratin 8
dog(486513) keratin 8
sheep(101110495) keratin 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4501653 Anti-Keratin 8 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501654 Anti-Keratin 8 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501655 Anti-Keratin 8 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB5500133 Anti-Keratin 8 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP102, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB1105165 Anti-KRT8 (467-478) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB4300552 Anti-KRT8 (Ab-74) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
AV42028 Anti-KRT8 (AB1) antibody produced in rabbit affinity isolated antibody horse, human, guinea pig, rat, mouse, bovine, pig
immunohistochemistry, western blot pricing
AV42029 Anti-KRT8 (AB2) antibody produced in rabbit affinity isolated antibody rat, mouse, human, rabbit, guinea pig, rabbit, canine, bovine, horse
immunohistochemistry, western blot pricing
SAB1406070 Anti-KRT8 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2701923 Anti-krt8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2701925 Anti-krt8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry pricing
SAB2701684 Anti-krt8 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA049866 Anti-KRT8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
GW22752 Anti-KRTB antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4504157 Anti-phospho-Keratin 8 (pSer432) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4301538 Anti-phospho-Keratin 8 (pSer432) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4503768 Anti-phospho-Keratin 8 (pSer73) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300240 Anti-phospho-KRT8 (pSer74) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
C5301 Monoclonal Anti-Cytokeratin Peptide 8 antibody produced in mouse clone M20, ascites fluid feline, rabbit, bovine, canine, human
immunofluorescence, immunohistochemistry, western blot pricing
C2562 Monoclonal Anti-Cytokeratin, pan (Mixture) antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunofluorescence, immunohistochemistry, western blot pricing
C9687 Monoclonal Anti-Cytokeratin, pan (Mixture) Prediluted antibody produced in mouse clone C-11+PCK-26+CY-90+KS-1A3+M20+A53-B/A2, ascites fluid wide range
immunohistochemistry pricing
C2931 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, ascites fluid bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
C1801 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse ascites fluid, clone PCK-26 lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing
P2871 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunocytochemistry, immunohistochemistry, microarray, western blot pricing
C5992 Monoclonal Anti-Cytokeratin, pan antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
dot blot, immunocytochemistry, immunohistochemistry, western blot pricing
F3418 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone C-11, purified immunoglobulin, buffered aqueous solution bovine, frog, rat, human, kangaroo rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
F0397 Monoclonal Anti-Cytokeratin, pan−FITC antibody produced in mouse clone PCK-26, purified immunoglobulin, buffered aqueous solution lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry pricing
C1041 Monoclonal Anti-Desmosomal Cytokeratin antibody produced in mouse clone DK80.20, ascites fluid human, bovine
electron microscopy, immunofluorescence, immunohistochemistry, western blot pricing
SAB1402246 Monoclonal Anti-KRT8 antibody produced in mouse clone 3E3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SRE0061 Monoclonal Anti-pan-Cytokeratin clone PCK-26, Reagents designed and manufactured under cGMP controls suitable for use in an IVD application. lizard, goat, bovine, human, hamster, rat, carp, guinea pig, pig, rabbit, sheep, mouse, chicken, snake, feline, canine
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002273 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002273 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002273 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031170 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031170 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031170 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Related Products

Product # Description Species Add to Cart
 
MAB3414 Anti-Cytokeratin 8 Antibody, clone 4.1.18 This Anti-Cytokeratin 8 Antibody, clone 4.1.18 is validated for use in WB, IC, IH, IH(P) for the detection of Cytokeratin 8. pricing
MABT329M Anti-Cytokeratin 8 Antibody, clone TROMA-1 This rat monoclonal Anti-Cytokeratin 8, clone TROMA-1, Cat. No. MABT329, is a rat monoclonal antibody that detects cytokeratin-8 in human and murine cells & is tested for use in Immunocytochemistry, Immunofluorescence, Immunohistochemistry (Paraffin), Immunoprecipitation, Radioimmunoassay, & WB., This rat monoclonal Anti-Cytokeratin 8, clone TROMA-1, Cat. No. MABT329, is a rat monoclonal antibody that detects cytokeratin-8 in human and murine cells & is tested for use in Immunocytochemistry, Immunofluorescence, Immunohistochemistry (Paraffin), Immunoprecipitation, Radioimmunoassay, & WB. pricing
MAB1612 Anti-Cytokeratin Epithelial Antibody, clone AE1 This Anti-Cytokeratin Epithelial Antibody, clone AE1 is validated for use in IH(P) for the detection of Cytokeratin Epithelial. pricing
MAB1611 Anti-Keratin Epithelial Antibody, clone AE3 Anti-Keratin Epithelial Antibody, clone AE3 is an antibody against Keratin Epithelial for use in WB, IH(P). pricing
ABT1372 Anti-phospho-Keratin-8 Antibody (Ser23) This rabbit polyclonal Anti-phospho-Keratin-8 (Ser23), Cat. No. ABT1372 is validated for use in Peptide Inhibition Assay and Western Blotting for the detection of Keratin 8 phosphorylated at serine 23. pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002273 Rosetta Predictions human pricing
NM_199370 Rosetta Predictions rat pricing
NM_031170 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00333544 predicted 980
2 SASI_Hs02_00333545 predicted 484
3 SASI_Hs02_00333546 predicted 487
4 SASI_Hs02_00333547 predicted 543
5 SASI_Hs02_00333548 predicted 1000
6 SASI_Hs02_00333549 predicted 994
7 SASI_Hs02_00333550 predicted 993
8 SASI_Hs01_00166576 predicted 1594
9 SASI_Hs02_00333551 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00270169 predicted 1425
2 SASI_Rn02_00270170 predicted 1431
3 SASI_Rn02_00270171 predicted 405
4 SASI_Rn02_00270172 predicted 1354
5 SASI_Rn02_00270173 predicted 921
6 SASI_Rn01_00080771 predicted 882
7 SASI_Rn02_00270174 predicted 395
8 SASI_Rn02_00270175 predicted 538
9 SASI_Rn02_00270176 predicted 673
10 SASI_Rn02_00270177 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031170 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166813 predicted 1008
2 SASI_Mm01_00166815 predicted 952
3 SASI_Mm02_00336997 predicted 1550
4 SASI_Mm02_00336998 predicted 947
5 SASI_Mm01_00166816 predicted 1400
6 SASI_Mm01_00166817 predicted 1024
7 SASI_Mm02_00336999 predicted 1475
8 SASI_Mm01_00166819 predicted 1508
9 SASI_Mm01_00166820 predicted 816
10 SASI_Mm02_00337000 predicted 497
11 SASI_Mm01_00166811 predicted 901
12 SASI_Mm01_00166812 predicted 977
13 SASI_Mm01_00166814 predicted 896
14 SASI_Mm01_00166818 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002273
KRT8 MISSION shRNA Bacterial Glycerol Stock
keratin 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-894s21c1
Sequence:CCGGAGGCACAGTACGAGGATATTGCTCGAGCAATATCCTCGTACTGTGCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-1317s21c1
Sequence:CCGGGGATGCAGAACATGAGTATTCCTCGAGGAATACTCATGTTCTGCATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-819s1c1
Sequence:CCGGCTGGACATGGACAGCATCATTCTCGAGAATGATGCTGTCCATGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-366s1c1
Sequence:CCGGGCCTCCTTCATAGACAAGGTACTCGAGTACCTTGTCTATGAAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-455s1c1
Sequence:CCGGTCGAAGCAACATGGACAACATCTCGAGATGTTGTCCATGTTGCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-338s1c1
Sequence:CCGGGCAGATCAAGACCCTCAACAACTCGAGTTGTTGAGGGTCTTGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-734s1c1
Sequence:CCGGGCAGCTATATGAAGAGGAGATCTCGAGATCTCCTCTTCATATAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002273
KRT8 MISSION shRNA shRNA Plasmid DNA
keratin 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-894s21c1
Sequence:CCGGAGGCACAGTACGAGGATATTGCTCGAGCAATATCCTCGTACTGTGCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-1317s21c1
Sequence:CCGGGGATGCAGAACATGAGTATTCCTCGAGGAATACTCATGTTCTGCATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-819s1c1
Sequence:CCGGCTGGACATGGACAGCATCATTCTCGAGAATGATGCTGTCCATGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-366s1c1
Sequence:CCGGGCCTCCTTCATAGACAAGGTACTCGAGTACCTTGTCTATGAAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-455s1c1
Sequence:CCGGTCGAAGCAACATGGACAACATCTCGAGATGTTGTCCATGTTGCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-338s1c1
Sequence:CCGGGCAGATCAAGACCCTCAACAACTCGAGTTGTTGAGGGTCTTGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-734s1c1
Sequence:CCGGGCAGCTATATGAAGAGGAGATCTCGAGATCTCCTCTTCATATAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002273
KRT8 MISSION shRNA Lentiviral Transduction Particles
keratin 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-894s21c1
Sequence:CCGGAGGCACAGTACGAGGATATTGCTCGAGCAATATCCTCGTACTGTGCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421337    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002273.3-1317s21c1
Sequence:CCGGGGATGCAGAACATGAGTATTCCTCGAGGAATACTCATGTTCTGCATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-819s1c1
Sequence:CCGGCTGGACATGGACAGCATCATTCTCGAGAATGATGCTGTCCATGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-366s1c1
Sequence:CCGGGCCTCCTTCATAGACAAGGTACTCGAGTACCTTGTCTATGAAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-455s1c1
Sequence:CCGGTCGAAGCAACATGGACAACATCTCGAGATGTTGTCCATGTTGCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-338s1c1
Sequence:CCGGGCAGATCAAGACCCTCAACAACTCGAGTTGTTGAGGGTCTTGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002273.1-734s1c1
Sequence:CCGGGCAGCTATATGAAGAGGAGATCTCGAGATCTCCTCTTCATATAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031170
VALIDATED
KRT8 MISSION shRNA Bacterial Glycerol Stock
keratin 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-967s21c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1042s21c1
Sequence:CCGGCTCCGAGATGAACCGCAACATCTCGAGATGTTGCGGTTCATCTCGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-845s21c1
Sequence:CCGGACGTCTGTGGTGCTGTCTATGCTCGAGCATAGACAGCACCACAGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-675s21c1
Sequence:CCGGAGCGTACAGAGATGGAGAATGCTCGAGCATTCTCCATCTCTGTACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1417s21c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031170.1-1549s1c1
Sequence:CCGGGTATGGCAGAGATCAGGGATACTCGAGTATCCCTGATCTCTGCCATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-887s1c1
Sequence:CCGGTGAAACCATGTACCAGATTAACTCGAGTTAATCTGGTACATGGTTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-332s1c1
Sequence:CCGGGCAGATTAAATCCCTGAACAACTCGAGTTGTTCAGGGATTTAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-1349s1c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-899s1c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031170
VALIDATED
KRT8 MISSION shRNA shRNA Plasmid DNA
keratin 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-967s21c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1042s21c1
Sequence:CCGGCTCCGAGATGAACCGCAACATCTCGAGATGTTGCGGTTCATCTCGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-845s21c1
Sequence:CCGGACGTCTGTGGTGCTGTCTATGCTCGAGCATAGACAGCACCACAGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-675s21c1
Sequence:CCGGAGCGTACAGAGATGGAGAATGCTCGAGCATTCTCCATCTCTGTACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000325588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1417s21c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031170.1-1549s1c1
Sequence:CCGGGTATGGCAGAGATCAGGGATACTCGAGTATCCCTGATCTCTGCCATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-887s1c1
Sequence:CCGGTGAAACCATGTACCAGATTAACTCGAGTTAATCTGGTACATGGTTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-332s1c1
Sequence:CCGGGCAGATTAAATCCCTGAACAACTCGAGTTGTTCAGGGATTTAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-1349s1c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-899s1c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031170
VALIDATED
KRT8 MISSION shRNA Lentiviral Transduction Particles
keratin 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-967s21c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1042s21c1
Sequence:CCGGCTCCGAGATGAACCGCAACATCTCGAGATGTTGCGGTTCATCTCGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-845s21c1
Sequence:CCGGACGTCTGTGGTGCTGTCTATGCTCGAGCATAGACAGCACCACAGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-675s21c1
Sequence:CCGGAGCGTACAGAGATGGAGAATGCTCGAGCATTCTCCATCTCTGTACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000325588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031170.2-1417s21c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091873    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031170.1-1549s1c1
Sequence:CCGGGTATGGCAGAGATCAGGGATACTCGAGTATCCCTGATCTCTGCCATACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-887s1c1
Sequence:CCGGTGAAACCATGTACCAGATTAACTCGAGTTAATCTGGTACATGGTTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031170.1-332s1c1
Sequence:CCGGGCAGATTAAATCCCTGAACAACTCGAGTTGTTCAGGGATTTAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-1349s1c1
Sequence:CCGGCCCTGGCTTCAGCTACGGAATCTCGAGATTCCGTAGCTGAAGCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031170.1-899s1c1
Sequence:CCGGCCAGATTAAGTATGAGGAATTCTCGAGAATTCCTCATACTTAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)