EMAIL THIS PAGE TO A FRIEND

KRT9

keratin 9

52 Gene Product Result for
Synonyms: CK-9 EPPK K9
UniProtKB ID: P35527, O00109, Q0IJ47, Q14665
Gene ID:
Human(3857) Summary: This gene encodes the type I keratin 9, an intermediate filament chain expressed only in the terminally differentiated epidermis of palms and soles. Mutations in this gene cause epidermolytic palmoplantar keratoderma. [provided by RefSeq, Jul 2008]
Mouse(107656) keratin 9
Rat(266717) keratin 9
dog(490980) keratin 9
cow(788727) keratin 9
sheep(101107880) keratin 9
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000226 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000226 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000226 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201255 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201255 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201255 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000226 Rosetta Predictions human pricing
NM_153476 Rosetta Predictions rat pricing
NM_201255 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000226 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076922 predicted 765
2 SASI_Hs02_00302128 predicted 853
3 SASI_Hs01_00076923 predicted 948
4 SASI_Hs01_00076924 predicted 995
5 SASI_Hs01_00076925 predicted 761
6 SASI_Hs01_00076926 predicted 964
7 SASI_Hs01_00076927 predicted 818
8 SASI_Hs01_00076928 predicted 925
9 SASI_Hs01_00076929 predicted 1018
10 SASI_Hs01_00076930 predicted 1108
11 SASI_Hs01_00076931 predicted 1278
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153476 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097401 predicted 1041
2 SASI_Rn01_00097402 predicted 1402
3 SASI_Rn01_00097403 predicted 895
4 SASI_Rn01_00097404 predicted 975
5 SASI_Rn01_00097405 predicted 630
6 SASI_Rn01_00097406 predicted 921
7 SASI_Rn01_00097407 predicted 1221
8 SASI_Rn01_00097408 predicted 846
9 SASI_Rn01_00097409 predicted 676
10 SASI_Rn01_00097410 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201255 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149491 predicted 1397
2 SASI_Mm01_00149492 predicted 2248
3 SASI_Mm01_00149494 predicted 1387
4 SASI_Mm01_00149495 predicted 953
5 SASI_Mm01_00149496 predicted 783
6 SASI_Mm02_00351499 predicted 1265
7 SASI_Mm01_00149497 predicted 763
8 SASI_Mm02_00351500 predicted 922
9 SASI_Mm02_00351501 predicted 806
10 SASI_Mm01_00149499 predicted 2330
11 SASI_Mm01_00149490 predicted 1032
12 SASI_Mm01_00149493 predicted 869
13 SASI_Mm01_00149498 predicted 1050
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000226
KRT9 MISSION shRNA Bacterial Glycerol Stock
keratin 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000226.2-1989s1c1
Sequence:CCGGGCGATACTAGAGCCTCTGTAACTCGAGTTACAGAGGCTCTAGTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1871s1c1
Sequence:CCGGGCGGTGAAGAAGCGAGTGGAACTCGAGTTCCACTCGCTTCTTCACCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-923s1c1
Sequence:CCGGTGGCCCTCAAGAAGAATCATACTCGAGTATGATTCTTCTTGAGGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-555s1c1
Sequence:CCGGGCTGGCCTCTTACTTGGATAACTCGAGTTATCCAAGTAAGAGGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1062s1c1
Sequence:CCGGGCTCATTGCTAAGAACAGAAACTCGAGTTTCTGTTCTTAGCAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-502s21c1
Sequence:CCGGGGTGGTATTCTGACTGCTAATCTCGAGATTAGCAGTCAGAATACCACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-770s21c1
Sequence:CCGGCACTGGATGACTTCAGGATAACTCGAGTTATCCTGAAGTCATCCAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-971s21c1
Sequence:CCGGAGAACAGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACTGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000226.3-2125s21c1
Sequence:CCGGGACTGAACTGACTTGGCATATCTCGAGATATGCCAAGTCAGTTCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000226
KRT9 MISSION shRNA shRNA Plasmid DNA
keratin 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000226.2-1989s1c1
Sequence:CCGGGCGATACTAGAGCCTCTGTAACTCGAGTTACAGAGGCTCTAGTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1871s1c1
Sequence:CCGGGCGGTGAAGAAGCGAGTGGAACTCGAGTTCCACTCGCTTCTTCACCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-923s1c1
Sequence:CCGGTGGCCCTCAAGAAGAATCATACTCGAGTATGATTCTTCTTGAGGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-555s1c1
Sequence:CCGGGCTGGCCTCTTACTTGGATAACTCGAGTTATCCAAGTAAGAGGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1062s1c1
Sequence:CCGGGCTCATTGCTAAGAACAGAAACTCGAGTTTCTGTTCTTAGCAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-502s21c1
Sequence:CCGGGGTGGTATTCTGACTGCTAATCTCGAGATTAGCAGTCAGAATACCACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-770s21c1
Sequence:CCGGCACTGGATGACTTCAGGATAACTCGAGTTATCCTGAAGTCATCCAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-971s21c1
Sequence:CCGGAGAACAGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACTGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000226.3-2125s21c1
Sequence:CCGGGACTGAACTGACTTGGCATATCTCGAGATATGCCAAGTCAGTTCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000226
KRT9 MISSION shRNA Lentiviral Transduction Particles
keratin 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000226.2-1989s1c1
Sequence:CCGGGCGATACTAGAGCCTCTGTAACTCGAGTTACAGAGGCTCTAGTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1871s1c1
Sequence:CCGGGCGGTGAAGAAGCGAGTGGAACTCGAGTTCCACTCGCTTCTTCACCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-923s1c1
Sequence:CCGGTGGCCCTCAAGAAGAATCATACTCGAGTATGATTCTTCTTGAGGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-555s1c1
Sequence:CCGGGCTGGCCTCTTACTTGGATAACTCGAGTTATCCAAGTAAGAGGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000226.2-1062s1c1
Sequence:CCGGGCTCATTGCTAAGAACAGAAACTCGAGTTTCTGTTCTTAGCAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-502s21c1
Sequence:CCGGGGTGGTATTCTGACTGCTAATCTCGAGATTAGCAGTCAGAATACCACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-770s21c1
Sequence:CCGGCACTGGATGACTTCAGGATAACTCGAGTTATCCTGAAGTCATCCAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000226.3-971s21c1
Sequence:CCGGAGAACAGTGGAGATGTCAATGCTCGAGCATTGACATCTCCACTGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000226.3-2125s21c1
Sequence:CCGGGACTGAACTGACTTGGCATATCTCGAGATATGCCAAGTCAGTTCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201255
KRT9 MISSION shRNA Bacterial Glycerol Stock
keratin 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201255.1-2396s1c1
Sequence:CCGGCGTTTGGAACTGGATGGAGTTCTCGAGAACTCCATCCAGTTCCAAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-991s1c1
Sequence:CCGGCCAGGACATTGAACAACACTACTCGAGTAGTGTTGTTCAATGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-568s1c1
Sequence:CCGGCCAGAAGGACAACACTCATTACTCGAGTAATGAGTGTTGTCCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-992s1c1
Sequence:CCGGCAGGACATTGAACAACACTATCTCGAGATAGTGTTGTTCAATGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-470s1c1
Sequence:CCGGGCCTCTTACATGGAGAAAGTACTCGAGTACTTTCTCCATGTAAGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201255
KRT9 MISSION shRNA shRNA Plasmid DNA
keratin 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201255.1-2396s1c1
Sequence:CCGGCGTTTGGAACTGGATGGAGTTCTCGAGAACTCCATCCAGTTCCAAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-991s1c1
Sequence:CCGGCCAGGACATTGAACAACACTACTCGAGTAGTGTTGTTCAATGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-568s1c1
Sequence:CCGGCCAGAAGGACAACACTCATTACTCGAGTAATGAGTGTTGTCCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-992s1c1
Sequence:CCGGCAGGACATTGAACAACACTATCTCGAGATAGTGTTGTTCAATGTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000090384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-470s1c1
Sequence:CCGGGCCTCTTACATGGAGAAAGTACTCGAGTACTTTCTCCATGTAAGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201255
KRT9 MISSION shRNA Lentiviral Transduction Particles
keratin 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090383    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201255.1-2396s1c1
Sequence:CCGGCGTTTGGAACTGGATGGAGTTCTCGAGAACTCCATCCAGTTCCAAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-991s1c1
Sequence:CCGGCCAGGACATTGAACAACACTACTCGAGTAGTGTTGTTCAATGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-568s1c1
Sequence:CCGGCCAGAAGGACAACACTCATTACTCGAGTAATGAGTGTTGTCCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-992s1c1
Sequence:CCGGCAGGACATTGAACAACACTATCTCGAGATAGTGTTGTTCAATGTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000090384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201255.1-470s1c1
Sequence:CCGGGCCTCTTACATGGAGAAAGTACTCGAGTACTTTCTCCATGTAAGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)