EMAIL THIS PAGE TO A FRIEND

KRTAP1-1

keratin associated protein 1-1

26 Gene Product Result for
Synonyms: HB2A KAP1.1 KAP1.1A KAP1.1B KAP1.6 KAP1.7 KRTAP1.1 KRTAP1A hKAP1.7
UniProtKB ID: Q07627, A6NC32, Q96S60, Q96S67
Gene ID:
Human(81851) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Rat(100361571) keratin associated protein 1-1
cow(514995) keratin associated protein 1-1
sheep(100294612) keratin associated protein 1-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301137 ANTI-KRTAP1-1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030967 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030967 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030967 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030967 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030967 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214713 predicted 578
2 SASI_Hs01_00214715 predicted 571
3 SASI_Hs01_00214716 predicted 239
4 SASI_Hs01_00214717 predicted 621
5 SASI_Hs01_00214719 predicted 657
6 SASI_Hs01_00214720 predicted 676
7 SASI_Hs01_00214721 predicted 610
8 SASI_Hs01_00214722 predicted 246
9 SASI_Hs01_00214714 predicted 280
10 SASI_Hs01_00214718 predicted 669
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030967
KRTAP1-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-697s21c1
Sequence:CCGGTTGCAACCTCTCATCACACAGCTCGAGCTGTGTGATGAGAGGTTGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-652s21c1
Sequence:CCGGTTAGAATCCTAACAATCTTCTCTCGAGAGAAGATTGTTAGGATTCTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-620s1c1
Sequence:CCGGCCTGATAAGATGGCACCTTAACTCGAGTTAAGGTGCCATCTTATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-713s1c1
Sequence:CCGGCACAGCCACATAAATTCCCTACTCGAGTAGGGAATTTATGTGGCTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-228s1c1
Sequence:CCGGGTGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-717s1c1
Sequence:CCGGGCCACATAAATTCCCTAGGAACTCGAGTTCCTAGGGAATTTATGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-683s21c1
Sequence:CCGGACCTATAACTGGGCTTGCAACCTCGAGGTTGCAAGCCCAGTTATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030967.2-253s21c1
Sequence:CCGGTGGGACTTGTGACTCTAGCTGCTCGAGCAGCTAGAGTCACAAGTCCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-222s1c1
Sequence:CCGGGCTTCTGTGGATTTCCTAGCTCTCGAGAGCTAGGAAATCCACAGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-282s1c1
Sequence:CCGGCAAGCTGCTGTGAAACTAGCTCTCGAGAGCTAGTTTCACAGCAGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030967
KRTAP1-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-697s21c1
Sequence:CCGGTTGCAACCTCTCATCACACAGCTCGAGCTGTGTGATGAGAGGTTGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-652s21c1
Sequence:CCGGTTAGAATCCTAACAATCTTCTCTCGAGAGAAGATTGTTAGGATTCTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-620s1c1
Sequence:CCGGCCTGATAAGATGGCACCTTAACTCGAGTTAAGGTGCCATCTTATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000146496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-713s1c1
Sequence:CCGGCACAGCCACATAAATTCCCTACTCGAGTAGGGAATTTATGTGGCTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-228s1c1
Sequence:CCGGGTGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-717s1c1
Sequence:CCGGGCCACATAAATTCCCTAGGAACTCGAGTTCCTAGGGAATTTATGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-683s21c1
Sequence:CCGGACCTATAACTGGGCTTGCAACCTCGAGGTTGCAAGCCCAGTTATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030967.2-253s21c1
Sequence:CCGGTGGGACTTGTGACTCTAGCTGCTCGAGCAGCTAGAGTCACAAGTCCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-222s1c1
Sequence:CCGGGCTTCTGTGGATTTCCTAGCTCTCGAGAGCTAGGAAATCCACAGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-282s1c1
Sequence:CCGGCAAGCTGCTGTGAAACTAGCTCTCGAGAGCTAGTTTCACAGCAGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030967
KRTAP1-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429177    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-697s21c1
Sequence:CCGGTTGCAACCTCTCATCACACAGCTCGAGCTGTGTGATGAGAGGTTGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417254    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-652s21c1
Sequence:CCGGTTAGAATCCTAACAATCTTCTCTCGAGAGAAGATTGTTAGGATTCTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178789    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-620s1c1
Sequence:CCGGCCTGATAAGATGGCACCTTAACTCGAGTTAAGGTGCCATCTTATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000146496    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-713s1c1
Sequence:CCGGCACAGCCACATAAATTCCCTACTCGAGTAGGGAATTTATGTGGCTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-228s1c1
Sequence:CCGGGTGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030967.2-717s1c1
Sequence:CCGGGCCACATAAATTCCCTAGGAACTCGAGTTCCTAGGGAATTTATGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030967.2-683s21c1
Sequence:CCGGACCTATAACTGGGCTTGCAACCTCGAGGTTGCAAGCCCAGTTATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030967.2-253s21c1
Sequence:CCGGTGGGACTTGTGACTCTAGCTGCTCGAGCAGCTAGAGTCACAAGTCCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-222s1c1
Sequence:CCGGGCTTCTGTGGATTTCCTAGCTCTCGAGAGCTAGGAAATCCACAGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030967.2-282s1c1
Sequence:CCGGCAAGCTGCTGTGAAACTAGCTCTCGAGAGCTAGTTTCACAGCAGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)