EMAIL THIS PAGE TO A FRIEND

KRTAP1-3

keratin associated protein 1-3

43 Gene Product Result for
Synonyms: KAP1.2 KAP1.3 KAP1.6 KAP1.8A KAP1.8B KAP1.9 KRTAP1.3
UniProtKB ID: Q8IUG1, Q07628, Q8IUG0, Q9BYS2
Gene ID:
Human(81850) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(435273) keratin associated protein 1-3
Rat(680104) keratin associated protein 1-3
sheep(100294613) keratin associated protein 1-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302303 ANTI-KRTAP1-3 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030966 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030966 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030966 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001085526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001085526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001085526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030966 Rosetta Predictions human pricing
XM_001055744 Rosetta Predictions rat pricing
NM_001085526 Rosetta Predictions mouse pricing
XM_487185 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030966 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130681 predicted 577
2 SASI_Hs02_00358555 predicted 551
3 SASI_Hs01_00130682 predicted 608
4 SASI_Hs01_00130683 predicted 740
5 SASI_Hs01_00130684 predicted 689
6 SASI_Hs01_00130685 predicted 621
7 SASI_Hs01_00130686 predicted 627
8 SASI_Hs01_00130687 predicted 605
9 SASI_Hs01_00130688 predicted 586
10 SASI_Hs01_00130689 predicted 575
11 SASI_Hs01_00130690 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055744 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280830 predicted 468
2 SASI_Rn02_00280831 predicted 263
3 SASI_Rn02_00280832 predicted 472
4 SASI_Rn02_00280833 predicted 478
5 SASI_Rn02_00280834 predicted 481
6 SASI_Rn02_00280835 predicted 249
7 SASI_Rn02_00280836 predicted 482
8 SASI_Rn02_00280837 predicted 280
9 SASI_Rn02_00280838 predicted 289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001085526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00300792 predicted 493
2 SASI_Mm02_00300793 predicted 598
3 SASI_Mm02_00300794 predicted 504
4 SASI_Mm02_00300795 predicted 550
5 SASI_Mm02_00300796 predicted 539
6 SASI_Mm02_00300797 predicted 544
7 SASI_Mm02_00300798 predicted 641
8 SASI_Mm02_00300799 predicted 496
9 SASI_Mm02_00300800 predicted 600
10 SASI_Mm02_00300801 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487185 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245529 predicted 479
2 SASI_Mm01_00245530 predicted 484
3 SASI_Mm01_00245531 predicted 487
4 SASI_Mm01_00245532 predicted 29
5 SASI_Mm01_00245533 predicted 487
6 SASI_Mm01_00245534 predicted 489
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030966
KRTAP1-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-168s1c1
Sequence:CCGGGCGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-171s1c1
Sequence:CCGGGATTTCCTAGCTTCTCAACTACTCGAGTAGTTGAGAAGCTAGGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-695s1c1
Sequence:CCGGGATTCCTTTCAATTCCAGAAACTCGAGTTTCTGGAATTGAAAGGAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-610s1c1
Sequence:CCGGGCACTTATGGACAACGAACAACTCGAGTTGTTCGTTGTCCATAAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-607s1c1
Sequence:CCGGCAAGCACTTATGGACAACGAACTCGAGTTCGTTGTCCATAAGTGCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-635s21c1
Sequence:CCGGTTCAACCTTTCTTTGTCTTTCCTCGAGGAAAGACAAAGAAAGGTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-581s21c1
Sequence:CCGGTTCCATTCATGAACGAATTATCTCGAGATAATTCGTTCATGAATGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-556s21c1
Sequence:CCGGTTCAACTTGAAATTTCCACTTCTCGAGAAGTGGAAATTTCAAGTTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030966
KRTAP1-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-168s1c1
Sequence:CCGGGCGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-171s1c1
Sequence:CCGGGATTTCCTAGCTTCTCAACTACTCGAGTAGTTGAGAAGCTAGGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-695s1c1
Sequence:CCGGGATTCCTTTCAATTCCAGAAACTCGAGTTTCTGGAATTGAAAGGAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-610s1c1
Sequence:CCGGGCACTTATGGACAACGAACAACTCGAGTTGTTCGTTGTCCATAAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-607s1c1
Sequence:CCGGCAAGCACTTATGGACAACGAACTCGAGTTCGTTGTCCATAAGTGCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-635s21c1
Sequence:CCGGTTCAACCTTTCTTTGTCTTTCCTCGAGGAAAGACAAAGAAAGGTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-581s21c1
Sequence:CCGGTTCCATTCATGAACGAATTATCTCGAGATAATTCGTTCATGAATGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-556s21c1
Sequence:CCGGTTCAACTTGAAATTTCCACTTCTCGAGAAGTGGAAATTTCAAGTTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030966
KRTAP1-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163496    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-168s1c1
Sequence:CCGGGCGGATTTCCTAGCTTCTCAACTCGAGTTGAGAAGCTAGGAAATCCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030966.1-171s1c1
Sequence:CCGGGATTTCCTAGCTTCTCAACTACTCGAGTAGTTGAGAAGCTAGGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159135    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-695s1c1
Sequence:CCGGGATTCCTTTCAATTCCAGAAACTCGAGTTTCTGGAATTGAAAGGAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161183    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-610s1c1
Sequence:CCGGGCACTTATGGACAACGAACAACTCGAGTTGTTCGTTGTCCATAAGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030966.1-607s1c1
Sequence:CCGGCAAGCACTTATGGACAACGAACTCGAGTTCGTTGTCCATAAGTGCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428664    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-635s21c1
Sequence:CCGGTTCAACCTTTCTTTGTCTTTCCTCGAGGAAAGACAAAGAAAGGTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425092    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-581s21c1
Sequence:CCGGTTCCATTCATGAACGAATTATCTCGAGATAATTCGTTCATGAATGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417173    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_030966.1-556s21c1
Sequence:CCGGTTCAACTTGAAATTTCCACTTCTCGAGAAGTGGAAATTTCAAGTTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001085526
KRTAP1-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-522s21c1
Sequence:CCGGTGCTGTGAGCCTACCTGTTAACTCGAGTTAACAGGTAGGCTCACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-203s21c1
Sequence:CCGGATCCAGTTGCTGCCAACCTTGCTCGAGCAAGGTTGGCAGCAACTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-540s21c1
Sequence:CCGGTAAGACCCAGGTTGCTGATTCCTCGAGGAATCAGCAACCTGGGTCTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085526.1-602s21c1
Sequence:CCGGCAAATACTTGGCCTTACTAAACTCGAGTTTAGTAAGGCCAAGTATTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-500s21c1
Sequence:CCGGACCCAGCTGCTCTGAGTCTAACTCGAGTTAGACTCAGAGCAGCTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001085526
KRTAP1-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-522s21c1
Sequence:CCGGTGCTGTGAGCCTACCTGTTAACTCGAGTTAACAGGTAGGCTCACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-203s21c1
Sequence:CCGGATCCAGTTGCTGCCAACCTTGCTCGAGCAAGGTTGGCAGCAACTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-540s21c1
Sequence:CCGGTAAGACCCAGGTTGCTGATTCCTCGAGGAATCAGCAACCTGGGTCTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085526.1-602s21c1
Sequence:CCGGCAAATACTTGGCCTTACTAAACTCGAGTTTAGTAAGGCCAAGTATTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000347082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-500s21c1
Sequence:CCGGACCCAGCTGCTCTGAGTCTAACTCGAGTTAGACTCAGAGCAGCTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001085526
KRTAP1-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-522s21c1
Sequence:CCGGTGCTGTGAGCCTACCTGTTAACTCGAGTTAACAGGTAGGCTCACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-203s21c1
Sequence:CCGGATCCAGTTGCTGCCAACCTTGCTCGAGCAAGGTTGGCAGCAACTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-540s21c1
Sequence:CCGGTAAGACCCAGGTTGCTGATTCCTCGAGGAATCAGCAACCTGGGTCTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001085526.1-602s21c1
Sequence:CCGGCAAATACTTGGCCTTACTAAACTCGAGTTTAGTAAGGCCAAGTATTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000347082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001085526.1-500s21c1
Sequence:CCGGACCCAGCTGCTCTGAGTCTAACTCGAGTTAGACTCAGAGCAGCTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)