EMAIL THIS PAGE TO A FRIEND

KRTAP1-4

keratin associated protein 1-4

13 Gene Product Result for
Synonyms: KAP1.4 KRTAP1.4
UniProtKB ID: P0C5Y4, A6NJ92
Gene ID:
Human(728255) Summary: The main structural proteins of mammalian hair fiber are the hair keratins (see MIM 601077) and the keratin-associated proteins (KAPs), which form a rigid and resistant hair shaft through extensive disulfide bond crosslinking with the abundant cysteines of hair keratins (Shimomura et al., 2002 [PubMed 12228244]
Mouse(629873) keratin associated protein 1-4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001039502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001039502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147010 predicted 621
2 SASI_Mm01_00147012 predicted 701
3 SASI_Mm01_00147013 predicted 833
4 SASI_Mm01_00147014 predicted 759
5 SASI_Mm01_00147015 predicted 865
6 SASI_Mm01_00147016 predicted 774
7 SASI_Mm01_00147017 predicted 762
8 SASI_Mm01_00147018 predicted 650
9 SASI_Mm01_00147019 predicted 622
10 SASI_Mm02_00290092 predicted 690
11 SASI_Mm01_00147011 predicted 680
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039502
KRTAP1-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000270829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-599s21c1
Sequence:CCGGTCTGAGCCCAGCTGTTAAGAACTCGAGTTCTTAACAGCTGGGCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-99s21c1
Sequence:CCGGGCGGCACATGTGGTTCTAACTCTCGAGAGTTAGAACCACATGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-616s21c1
Sequence:CCGGAGAACCAGGTTCCTGAATAGTCTCGAGACTATTCAGGAACCTGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-568s21c1
Sequence:CCGGTTGTGAGCCCAGCTGCTCTAACTCGAGTTAGAGCAGCTGGGCTCACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039502.2-847s21c1
Sequence:CCGGGGATGCAGCAGTACATCATTCCTCGAGGAATGATGTACTGCTGCATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039502
KRTAP1-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000270829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-599s21c1
Sequence:CCGGTCTGAGCCCAGCTGTTAAGAACTCGAGTTCTTAACAGCTGGGCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-99s21c1
Sequence:CCGGGCGGCACATGTGGTTCTAACTCTCGAGAGTTAGAACCACATGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-616s21c1
Sequence:CCGGAGAACCAGGTTCCTGAATAGTCTCGAGACTATTCAGGAACCTGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-568s21c1
Sequence:CCGGTTGTGAGCCCAGCTGCTCTAACTCGAGTTAGAGCAGCTGGGCTCACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039502.2-847s21c1
Sequence:CCGGGGATGCAGCAGTACATCATTCCTCGAGGAATGATGTACTGCTGCATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039502
KRTAP1-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000270829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-599s21c1
Sequence:CCGGTCTGAGCCCAGCTGTTAAGAACTCGAGTTCTTAACAGCTGGGCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-99s21c1
Sequence:CCGGGCGGCACATGTGGTTCTAACTCTCGAGAGTTAGAACCACATGTGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-616s21c1
Sequence:CCGGAGAACCAGGTTCCTGAATAGTCTCGAGACTATTCAGGAACCTGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001039502.2-568s21c1
Sequence:CCGGTTGTGAGCCCAGCTGCTCTAACTCGAGTTAGAGCAGCTGGGCTCACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001039502.2-847s21c1
Sequence:CCGGGGATGCAGCAGTACATCATTCCTCGAGGAATGATGTACTGCTGCATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)