EMAIL THIS PAGE TO A FRIEND

KRTAP1-5

keratin associated protein 1-5

81 Gene Product Result for
Synonyms: KAP1.5 KRTAP1.5
UniProtKB ID: Q9BYS1, A6NJW6, A6NLZ6, B6ZDR1, Q52LP6
Gene ID:
Human(83895) Summary: This protein is a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This protein is a member of the high sulfur KAP family and the gene is localized to a cluster of KAPs at 17q12-q21. [provided by RefSeq, Jul 2008]
Mouse(69664) keratin associated protein 1-5
Rat(497995) keratin associated protein 1-5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107555 Anti-KRTAP1-5 antibody produced in rabbit affinity isolated antibody goat, guinea pig, rabbit, horse, human, sheep
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031957 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031957 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031957 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU224411 MISSION® esiRNA esiRNA targeting human KRTAP1-5 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031957 Rosetta Predictions human pricing
NM_001025135 Rosetta Predictions rat pricing
NM_027157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025707 predicted 559
2 SASI_Hs01_00025708 predicted 657
3 SASI_Hs01_00025709 predicted 817
4 SASI_Hs01_00025710 predicted 645
5 SASI_Hs01_00025712 predicted 858
6 SASI_Hs01_00025713 predicted 678
7 SASI_Hs01_00025714 predicted 878
8 SASI_Hs01_00025715 predicted 564
9 SASI_Hs01_00025716 predicted 798
10 SASI_Hs02_00359133 predicted 863
11 SASI_Hs01_00025711 predicted 786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025135 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059678 predicted 157
2 SASI_Rn01_00059679 predicted 111
3 SASI_Rn01_00059680 predicted 71
4 SASI_Rn02_00203058 predicted 55
5 SASI_Rn01_00059683 predicted 77
6 SASI_Rn02_00203059 predicted 97
7 SASI_Rn01_00059684 predicted 174
8 SASI_Rn01_00059685 predicted 169
9 SASI_Rn01_00059686 predicted 240
10 SASI_Rn01_00059687 predicted 174
11 SASI_Rn01_00059681 predicted 25
12 SASI_Rn01_00059682 predicted 84
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126729 predicted 449
2 SASI_Mm01_00126730 predicted 663
3 SASI_Mm01_00126731 predicted 569
4 SASI_Mm01_00126732 predicted 604
5 SASI_Mm01_00126733 predicted 584
6 SASI_Mm01_00126734 predicted 286
7 SASI_Mm01_00126735 predicted 409
8 SASI_Mm01_00126736 predicted 420
9 SASI_Mm01_00126737 predicted 651
10 SASI_Mm01_00126738 predicted 454
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027157
KRTAP1-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-5
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-728s21c1
Sequence:CCGGAGAACAATCTGTAATCCTATTCTCGAGAATAGGATTACAGATTGTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-872s21c1
Sequence:CCGGCCAACTTCTGGCTGCTAAGAACTCGAGTTCTTAGCAGCCAGAAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027157.1-424s1c1
Sequence:CCGGCCACCTATTAAGAGCTAATTTCTCGAGAAATTAGCTCTTAATAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-362s1c1
Sequence:CCGGCCGTCCATCCTACTGTGGACACTCGAGTGTCCACAGTAGGATGGACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-297s1c1
Sequence:CCGGTGCTGTGTGGTGAGCTGTATACTCGAGTATACAGCTCACCACACAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-304s1c1
Sequence:CCGGTGGTGAGCTGTATACCCTCAACTCGAGTTGAGGGTATACAGCTCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-401s1c1
Sequence:CCGGCTGTTGCTGCTACTGCTGCTACTCGAGTAGCAGCAGTAGCAGCAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027157
KRTAP1-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-5
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-728s21c1
Sequence:CCGGAGAACAATCTGTAATCCTATTCTCGAGAATAGGATTACAGATTGTTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-872s21c1
Sequence:CCGGCCAACTTCTGGCTGCTAAGAACTCGAGTTCTTAGCAGCCAGAAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027157.1-424s1c1
Sequence:CCGGCCACCTATTAAGAGCTAATTTCTCGAGAAATTAGCTCTTAATAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-362s1c1
Sequence:CCGGCCGTCCATCCTACTGTGGACACTCGAGTGTCCACAGTAGGATGGACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-297s1c1
Sequence:CCGGTGCTGTGTGGTGAGCTGTATACTCGAGTATACAGCTCACCACACAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-304s1c1
Sequence:CCGGTGGTGAGCTGTATACCCTCAACTCGAGTTGAGGGTATACAGCTCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-401s1c1
Sequence:CCGGCTGTTGCTGCTACTGCTGCTACTCGAGTAGCAGCAGTAGCAGCAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027157
KRTAP1-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-5
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-728s21c1
Sequence:CCGGAGAACAATCTGTAATCCTATTCTCGAGAATAGGATTACAGATTGTTCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027157.3-872s21c1
Sequence:CCGGCCAACTTCTGGCTGCTAAGAACTCGAGTTCTTAGCAGCCAGAAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098490    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027157.1-424s1c1
Sequence:CCGGCCACCTATTAAGAGCTAATTTCTCGAGAAATTAGCTCTTAATAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-362s1c1
Sequence:CCGGCCGTCCATCCTACTGTGGACACTCGAGTGTCCACAGTAGGATGGACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-297s1c1
Sequence:CCGGTGCTGTGTGGTGAGCTGTATACTCGAGTATACAGCTCACCACACAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-304s1c1
Sequence:CCGGTGGTGAGCTGTATACCCTCAACTCGAGTTGAGGGTATACAGCTCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098494    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027157.1-401s1c1
Sequence:CCGGCTGTTGCTGCTACTGCTGCTACTCGAGTAGCAGCAGTAGCAGCAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031957
KRTAP1-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 1-5
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-715s21c1
Sequence:CCGGATCTGATTCCATTCTACAATGCTCGAGCATTGTAGAATGGAATCAGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-818s21c1
Sequence:CCGGTGATATTTCTGCAGGATTAAACTCGAGTTTAATCCTGCAGAAATATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031957.1-170s21c1
Sequence:CCGGGACTAGCTTCTGCGGATTTCCCTCGAGGGAAATCCGCAGAAGCTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-844s21c1
Sequence:CCGGCTGACATGTTGTGGAATTTATCTCGAGATAAATTCCACAACATGTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-884s1c1
Sequence:CCGGGTCTAATGTTTCCATGCTTTACTCGAGTAAAGCATGGAAACATTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-878s1c1
Sequence:CCGGCCACAAGTCTAATGTTTCCATCTCGAGATGGAAACATTAGACTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-787s1c1
Sequence:CCGGGATCATCAATTTGCTTGGGATCTCGAGATCCCAAGCAAATTGATGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-939s1c1
Sequence:CCGGGCAACATCAAAGACACCAAATCTCGAGATTTGGTGTCTTTGATGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031957
KRTAP1-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 1-5
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-715s21c1
Sequence:CCGGATCTGATTCCATTCTACAATGCTCGAGCATTGTAGAATGGAATCAGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-818s21c1
Sequence:CCGGTGATATTTCTGCAGGATTAAACTCGAGTTTAATCCTGCAGAAATATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031957.1-170s21c1
Sequence:CCGGGACTAGCTTCTGCGGATTTCCCTCGAGGGAAATCCGCAGAAGCTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-844s21c1
Sequence:CCGGCTGACATGTTGTGGAATTTATCTCGAGATAAATTCCACAACATGTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-884s1c1
Sequence:CCGGGTCTAATGTTTCCATGCTTTACTCGAGTAAAGCATGGAAACATTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-878s1c1
Sequence:CCGGCCACAAGTCTAATGTTTCCATCTCGAGATGGAAACATTAGACTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-787s1c1
Sequence:CCGGGATCATCAATTTGCTTGGGATCTCGAGATCCCAAGCAAATTGATGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-939s1c1
Sequence:CCGGGCAACATCAAAGACACCAAATCTCGAGATTTGGTGTCTTTGATGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031957
KRTAP1-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 1-5
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435106    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-715s21c1
Sequence:CCGGATCTGATTCCATTCTACAATGCTCGAGCATTGTAGAATGGAATCAGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434794    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-818s21c1
Sequence:CCGGTGATATTTCTGCAGGATTAAACTCGAGTTTAATCCTGCAGAAATATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435591    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031957.1-170s21c1
Sequence:CCGGGACTAGCTTCTGCGGATTTCCCTCGAGGGAAATCCGCAGAAGCTAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_031957.1-844s21c1
Sequence:CCGGCTGACATGTTGTGGAATTTATCTCGAGATAAATTCCACAACATGTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183601    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-884s1c1
Sequence:CCGGGTCTAATGTTTCCATGCTTTACTCGAGTAAAGCATGGAAACATTAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150074    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-878s1c1
Sequence:CCGGCCACAAGTCTAATGTTTCCATCTCGAGATGGAAACATTAGACTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147884    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-787s1c1
Sequence:CCGGGATCATCAATTTGCTTGGGATCTCGAGATCCCAAGCAAATTGATGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147911    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_031957.1-939s1c1
Sequence:CCGGGCAACATCAAAGACACCAAATCTCGAGATTTGGTGTCTTTGATGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)