EMAIL THIS PAGE TO A FRIEND

KRTAP10-10

keratin associated protein 10-10

31 Gene Product Result for
Synonyms: KAP10.10 KAP18.10 KRTAP18-10 KRTAP18.10
UniProtKB ID: P60014
Gene ID:
Mouse(544710) keratin associated protein 10-10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001024709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181688 Rosetta Predictions human pricing
NM_001024709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00162200 predicted 716
2 SASI_Hs02_00370281 predicted 762
3 SASI_Hs01_00162201 predicted 715
4 SASI_Hs01_00162202 predicted 635
5 SASI_Hs01_00162203 predicted 833
6 SASI_Hs01_00162204 predicted 1004
7 SASI_Hs01_00162205 predicted 98
8 SASI_Hs01_00162206 predicted 512
9 SASI_Hs01_00162207 predicted 506
10 SASI_Hs01_00162208 predicted 995
11 SASI_Hs01_00162209 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194439 predicted 948
2 SASI_Mm01_00194442 predicted 1008
3 SASI_Mm02_00287677 predicted 702
4 SASI_Mm01_00194443 predicted 1072
5 SASI_Mm02_00287678 predicted 847
6 SASI_Mm01_00194445 predicted 948
7 SASI_Mm02_00287679 predicted 993
8 SASI_Mm02_00287680 predicted 882
9 SASI_Mm02_00287681 predicted 985
10 SASI_Mm02_00287682 predicted 1001
11 SASI_Mm01_00194440 predicted 1086
12 SASI_Mm01_00194441 predicted 1083
13 SASI_Mm01_00194444 predicted 1006
14 SASI_Mm01_00194446 predicted 980
15 SASI_Mm01_00194447 predicted 1022
16 SASI_Mm01_00194448 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024709
KRTAP10-10 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-10
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000270449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-909s21c1
Sequence:CCGGTCTGAGGCCTCACCAGAATATCTCGAGATATTCTGGTGAGGCCTCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1008s21c1
Sequence:CCGGTGCCTTTCCACTGGCTATTTGCTCGAGCAAATAGCCAGTGGAAAGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1079s21c1
Sequence:CCGGAGACTTCAGGGAGACACTTTCCTCGAGGAAAGTGTCTCCCTGAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-950s21c1
Sequence:CCGGGCTTCACGTGGTATGAGTTACCTCGAGGTAACTCATACCACGTGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024709
KRTAP10-10 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-10
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000270449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-909s21c1
Sequence:CCGGTCTGAGGCCTCACCAGAATATCTCGAGATATTCTGGTGAGGCCTCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1008s21c1
Sequence:CCGGTGCCTTTCCACTGGCTATTTGCTCGAGCAAATAGCCAGTGGAAAGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1079s21c1
Sequence:CCGGAGACTTCAGGGAGACACTTTCCTCGAGGAAAGTGTCTCCCTGAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000270450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-950s21c1
Sequence:CCGGGCTTCACGTGGTATGAGTTACCTCGAGGTAACTCATACCACGTGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024709
KRTAP10-10 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-10
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000270449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-909s21c1
Sequence:CCGGTCTGAGGCCTCACCAGAATATCTCGAGATATTCTGGTGAGGCCTCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270402    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1008s21c1
Sequence:CCGGTGCCTTTCCACTGGCTATTTGCTCGAGCAAATAGCCAGTGGAAAGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270467    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-1079s21c1
Sequence:CCGGAGACTTCAGGGAGACACTTTCCTCGAGGAAAGTGTCTCCCTGAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000270450    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001024709.3-950s21c1
Sequence:CCGGGCTTCACGTGGTATGAGTTACCTCGAGGTAACTCATACCACGTGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181688
KRTAP10-10 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181688.1-894s1c1
Sequence:CCGGCTGGCTTTGACACCCTCAGAACTCGAGTTCTGAGGGTGTCAAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-386s1c1
Sequence:CCGGCTGTAACAAGCCTGTGTGCTTCTCGAGAAGCACACAGGCTTGTTACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-506s1c1
Sequence:CCGGGCCTGTCTGCTCTAAGTCCGTCTCGAGACGGACTTAGAGCAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-380s1c1
Sequence:CCGGGCCCGTCTGTAACAAGCCTGTCTCGAGACAGGCTTGTTACAGACGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-513s1c1
Sequence:CCGGTGCTCTAAGTCCGTCTGCTATCTCGAGATAGCAGACGGACTTAGAGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181688
KRTAP10-10 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181688.1-894s1c1
Sequence:CCGGCTGGCTTTGACACCCTCAGAACTCGAGTTCTGAGGGTGTCAAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-386s1c1
Sequence:CCGGCTGTAACAAGCCTGTGTGCTTCTCGAGAAGCACACAGGCTTGTTACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-506s1c1
Sequence:CCGGGCCTGTCTGCTCTAAGTCCGTCTCGAGACGGACTTAGAGCAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-380s1c1
Sequence:CCGGGCCCGTCTGTAACAAGCCTGTCTCGAGACAGGCTTGTTACAGACGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-513s1c1
Sequence:CCGGTGCTCTAAGTCCGTCTGCTATCTCGAGATAGCAGACGGACTTAGAGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181688
KRTAP10-10 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117142    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181688.1-894s1c1
Sequence:CCGGCTGGCTTTGACACCCTCAGAACTCGAGTTCTGAGGGTGTCAAAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-386s1c1
Sequence:CCGGCTGTAACAAGCCTGTGTGCTTCTCGAGAAGCACACAGGCTTGTTACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-506s1c1
Sequence:CCGGGCCTGTCTGCTCTAAGTCCGTCTCGAGACGGACTTAGAGCAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-380s1c1
Sequence:CCGGGCCCGTCTGTAACAAGCCTGTCTCGAGACAGGCTTGTTACAGACGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181688.1-513s1c1
Sequence:CCGGTGCTCTAAGTCCGTCTGCTATCTCGAGATAGCAGACGGACTTAGAGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)