EMAIL THIS PAGE TO A FRIEND

KRTAP10-11

keratin associated protein 10-11

16 Gene Product Result for
Synonyms: KAP10.11 KAP18.11 KRTAP18-11 KRTAP18.11
UniProtKB ID: P60412, A2RRF9
Gene ID:
cow(783371) keratin associated protein 10-11
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198692 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198692 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372267 predicted 965
2 SASI_Hs02_00372268 predicted 1002
3 SASI_Hs01_00013817 predicted 949
4 SASI_Hs01_00013818 predicted 965
5 SASI_Hs02_00372269 predicted 983
6 SASI_Hs01_00013819 predicted 931
7 SASI_Hs02_00372270 predicted 1175
8 SASI_Hs02_00372271 predicted 1090
9 SASI_Hs02_00372272 predicted 1194
10 SASI_Hs02_00372273 predicted 1160
11 SASI_Hs01_00013814 predicted 663
12 SASI_Hs01_00013815 predicted 635
13 SASI_Hs01_00013816 predicted 70
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198692
KRTAP10-11 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-11
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-671s1c1
Sequence:CCGGCTAGGGCTTCCTATTCACGCTCTCGAGAGCGTGAATAGGAAGCCCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-618s1c1
Sequence:CCGGTGTCTGCTGCAAGACTGTCTACTCGAGTAGACAGTCTTGCAGCAGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-624s1c1
Sequence:CCGGCTGCAAGACTGTCTACTGCAACTCGAGTTGCAGTAGACAGTCTTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-242s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCACCACTCGAGTGGTGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-665s1c1
Sequence:CCGGTCTGCTCTAGGGCTTCCTATTCTCGAGAATAGGAAGCCCTAGAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-966s21c1
Sequence:CCGGGACTGTGTCTTTGCTGCCAAGCTCGAGCTTGGCAGCAAAGACACAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-1016s21c1
Sequence:CCGGAGTCCTCAGAATCCACCAGCTCTCGAGAGCTGGTGGATTCTGAGGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198692
KRTAP10-11 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-11
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-671s1c1
Sequence:CCGGCTAGGGCTTCCTATTCACGCTCTCGAGAGCGTGAATAGGAAGCCCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-618s1c1
Sequence:CCGGTGTCTGCTGCAAGACTGTCTACTCGAGTAGACAGTCTTGCAGCAGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-624s1c1
Sequence:CCGGCTGCAAGACTGTCTACTGCAACTCGAGTTGCAGTAGACAGTCTTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-242s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCACCACTCGAGTGGTGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-665s1c1
Sequence:CCGGTCTGCTCTAGGGCTTCCTATTCTCGAGAATAGGAAGCCCTAGAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000443804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-966s21c1
Sequence:CCGGGACTGTGTCTTTGCTGCCAAGCTCGAGCTTGGCAGCAAAGACACAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000438290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-1016s21c1
Sequence:CCGGAGTCCTCAGAATCCACCAGCTCTCGAGAGCTGGTGGATTCTGAGGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198692
KRTAP10-11 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-11
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-671s1c1
Sequence:CCGGCTAGGGCTTCCTATTCACGCTCTCGAGAGCGTGAATAGGAAGCCCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116998    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-618s1c1
Sequence:CCGGTGTCTGCTGCAAGACTGTCTACTCGAGTAGACAGTCTTGCAGCAGACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-624s1c1
Sequence:CCGGCTGCAAGACTGTCTACTGCAACTCGAGTTGCAGTAGACAGTCTTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-242s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCACCACTCGAGTGGTGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116999    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198692.1-665s1c1
Sequence:CCGGTCTGCTCTAGGGCTTCCTATTCTCGAGAATAGGAAGCCCTAGAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000443804    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-966s21c1
Sequence:CCGGGACTGTGTCTTTGCTGCCAAGCTCGAGCTTGGCAGCAAAGACACAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000438290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198692.2-1016s21c1
Sequence:CCGGAGTCCTCAGAATCCACCAGCTCTCGAGAGCTGGTGGATTCTGAGGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)