EMAIL THIS PAGE TO A FRIEND

KRTAP10-1

keratin associated protein 10-1

9 Gene Product Result for
Synonyms: KAP10.1 KAP18-1 KAP18.1 KRTAP10.1 KRTAP18-1 KRTAP18.1
UniProtKB ID: P60331, Q0VAR0, Q0VAR1
Gene ID:
Human(386677) Summary: This gene encodes a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This gene encodes a member of the high sulfur KAP family. It is localized to a cluster of intronless KAPs at 21q22.3 which are located within the introns of the C21orf29 gene. [provided by RefSeq, Jul 2008]
dog(487805) keratin associated protein 10-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198691 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168664 predicted 761
2 SASI_Hs01_00168665 predicted 767
3 SASI_Hs01_00168666 predicted 770
4 SASI_Hs01_00168667 predicted 586
5 SASI_Hs01_00168668 predicted 595
6 SASI_Hs01_00168669 predicted 772
7 SASI_Hs02_00372266 predicted 948
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198691
KRTAP10-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-615s1c1
Sequence:CCGGGCCTGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-461s1c1
Sequence:CCGGAGTCCTGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCAGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-773s1c1
Sequence:CCGGCCTGCTGTATGCCTGTCTCCTCTCGAGAGGAGACAGGCATACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-474s1c1
Sequence:CCGGGCCTGTTTGCTGCAAGCCTGTCTCGAGACAGGCTTGCAGCAAACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-509s1c1
Sequence:CCGGCCTGCTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-416s21c1
Sequence:CCGGAGTCTAGCTGCCAGCCAACTTCTCGAGAAGTTGGCTGGCAGCTAGACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-428s21c1
Sequence:CCGGAGCCAACTTGCTGTGCCTCTTCTCGAGAAGAGGCACAGCAAGTTGGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-388s21c1
Sequence:CCGGTCTAAGGATTCCTCTTCATGCCTCGAGGCATGAAGAGGAATCCTTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-380s21c1
Sequence:CCGCCCACCTGCTCTAAGGATTCCTCTCGAGAGGAATCCTTAGAGCAGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198691
KRTAP10-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-615s1c1
Sequence:CCGGGCCTGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-461s1c1
Sequence:CCGGAGTCCTGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCAGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-773s1c1
Sequence:CCGGCCTGCTGTATGCCTGTCTCCTCTCGAGAGGAGACAGGCATACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-474s1c1
Sequence:CCGGGCCTGTTTGCTGCAAGCCTGTCTCGAGACAGGCTTGCAGCAAACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-509s1c1
Sequence:CCGGCCTGCTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-416s21c1
Sequence:CCGGAGTCTAGCTGCCAGCCAACTTCTCGAGAAGTTGGCTGGCAGCTAGACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-428s21c1
Sequence:CCGGAGCCAACTTGCTGTGCCTCTTCTCGAGAAGAGGCACAGCAAGTTGGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-388s21c1
Sequence:CCGGTCTAAGGATTCCTCTTCATGCCTCGAGGCATGAAGAGGAATCCTTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-380s21c1
Sequence:CCGCCCACCTGCTCTAAGGATTCCTCTCGAGAGGAATCCTTAGAGCAGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198691
KRTAP10-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-615s1c1
Sequence:CCGGGCCTGTCTGCTGCAAGCCCATCTCGAGATGGGCTTGCAGCAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-461s1c1
Sequence:CCGGAGTCCTGCTGTGTGCCTGTTTCTCGAGAAACAGGCACACAGCAGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-773s1c1
Sequence:CCGGCCTGCTGTATGCCTGTCTCCTCTCGAGAGGAGACAGGCATACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-474s1c1
Sequence:CCGGGCCTGTTTGCTGCAAGCCTGTCTCGAGACAGGCTTGCAGCAAACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198691.2-509s1c1
Sequence:CCGGCCTGCTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-416s21c1
Sequence:CCGGAGTCTAGCTGCCAGCCAACTTCTCGAGAAGTTGGCTGGCAGCTAGACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-428s21c1
Sequence:CCGGAGCCAACTTGCTGTGCCTCTTCTCGAGAAGAGGCACAGCAAGTTGGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-388s21c1
Sequence:CCGGTCTAAGGATTCCTCTTCATGCCTCGAGGCATGAAGAGGAATCCTTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198691.2-380s21c1
Sequence:CCGCCCACCTGCTCTAAGGATTCCTCTCGAGAGGAATCCTTAGAGCAGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)