EMAIL THIS PAGE TO A FRIEND

KRTAP10-5

keratin associated protein 10-5

7 Gene Product Result for
Synonyms: KAP10.5 KAP18-5 KAP18.5 KRTAP10.5 KRTAP18-5 KRTAP18.1 KRTAP18.5
Species: Human KRTAP10-5(386680)
UniProtKB ID: P60370, Q0VAR7, Q0VAR8, Q70LJ3
Gene ID:
Human(386680) Summary: This gene encodes a member of the keratin-associated protein (KAP) family. The KAP proteins form a matrix of keratin intermediate filaments which contribute to the structure of hair fibers. KAP family members appear to have unique, family-specific amino- and carboxyl-terminal regions and are subdivided into three multi-gene families according to amino acid composition: the high sulfur, the ultrahigh sulfur, and the high tyrosine/glycine KAPs. This gene encodes a member of the high sulfur KAP family. It is localized to a cluster of intronless KAPs at 21q22.3 which are located within the introns of the C21orf29 gene. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198694 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198694 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083597 predicted 852
2 SASI_Hs01_00083598 predicted 480
3 SASI_Hs01_00083599 predicted 58
4 SASI_Hs01_00083595 predicted 554
5 SASI_Hs01_00083596 predicted 559
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198694
KRTAP10-5 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-5
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-334s1c1
Sequence:CCGGGCTCTAAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTTAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-472s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCATTCTCGAGAATGCTGGCAGCATGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-457s1c1
Sequence:CCGGCCTGTTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-558s1c1
Sequence:CCGGTGCAAGCCTGTCTGCTTCAAACTCGAGTTTGAAGCAGACAGGCTTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-331s1c1
Sequence:CCGGCCTGCTCTAAGGATTCCTCTTCTCGAGAAGAGGAATCCTTAGAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-379s21c1
Sequence:CCGGCAACTTGCTGTGCCTCTTCCTCTCGAGAGGAAGAGGCACAGCAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-615s21c1
Sequence:CCGGACTTCATGCTGCCAGCAGTCTCTCGAGAGACTGCTGGCAGCATGAAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198694
KRTAP10-5 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-5
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-334s1c1
Sequence:CCGGGCTCTAAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTTAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-472s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCATTCTCGAGAATGCTGGCAGCATGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-457s1c1
Sequence:CCGGCCTGTTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-558s1c1
Sequence:CCGGTGCAAGCCTGTCTGCTTCAAACTCGAGTTTGAAGCAGACAGGCTTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-331s1c1
Sequence:CCGGCCTGCTCTAAGGATTCCTCTTCTCGAGAAGAGGAATCCTTAGAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-379s21c1
Sequence:CCGGCAACTTGCTGTGCCTCTTCCTCTCGAGAGGAAGAGGCACAGCAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-615s21c1
Sequence:CCGGACTTCATGCTGCCAGCAGTCTCTCGAGAGACTGCTGGCAGCATGAAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198694
KRTAP10-5 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-5
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-334s1c1
Sequence:CCGGGCTCTAAGGATTCCTCTTCATCTCGAGATGAAGAGGAATCCTTAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-472s1c1
Sequence:CCGGCCTCTTCATGCTGCCAGCATTCTCGAGAATGCTGGCAGCATGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-457s1c1
Sequence:CCGGCCTGTTCTGAGGATTCCTCTTCTCGAGAAGAGGAATCCTCAGAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-558s1c1
Sequence:CCGGTGCAAGCCTGTCTGCTTCAAACTCGAGTTTGAAGCAGACAGGCTTGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198694.2-331s1c1
Sequence:CCGGCCTGCTCTAAGGATTCCTCTTCTCGAGAAGAGGAATCCTTAGAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425283    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-379s21c1
Sequence:CCGGCAACTTGCTGTGCCTCTTCCTCTCGAGAGGAAGAGGCACAGCAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198694.2-615s21c1
Sequence:CCGGACTTCATGCTGCCAGCAGTCTCTCGAGAGACTGCTGGCAGCATGAAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)