EMAIL THIS PAGE TO A FRIEND

KRTAP10-6

keratin associated protein 10-6

4 Gene Product Result for
Synonyms: KAP10.6 KAP18.6 KRTAP18-6 KRTAP18.6
Species: Human KRTAP10-6(386674)
UniProtKB ID: P60371
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198688 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372255 predicted 1196
2 SASI_Hs02_00372256 predicted 1190
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198688
KRTAP10-6 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-6
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-1034s1c1
Sequence:CCGGCCTCCTGTGTTTCCCTCCTCTCTCGAGAGAGGAGGGAAACACAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-80s1c1
Sequence:CCGGGCCTTCCTGGTTCCTGTGACTCTCGAGAGTCACAGGAACCAGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-515s1c1
Sequence:CCGGGCTCTGGGATTTCCTCTTCGTCTCGAGACGAAGAGGAAATCCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-539s1c1
Sequence:CCGGGCCAGCAGTCTAGCTGTGTGACTCGAGTCACACAGCTAGACTGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-752s1c1
Sequence:CCGGCTGAGGATTCCTCTTCATGCTCTCGAGAGCATGAAGAGGAATCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198688
KRTAP10-6 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-6
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-1034s1c1
Sequence:CCGGCCTCCTGTGTTTCCCTCCTCTCTCGAGAGAGGAGGGAAACACAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-80s1c1
Sequence:CCGGGCCTTCCTGGTTCCTGTGACTCTCGAGAGTCACAGGAACCAGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-515s1c1
Sequence:CCGGGCTCTGGGATTTCCTCTTCGTCTCGAGACGAAGAGGAAATCCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-539s1c1
Sequence:CCGGGCCAGCAGTCTAGCTGTGTGACTCGAGTCACACAGCTAGACTGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-752s1c1
Sequence:CCGGCTGAGGATTCCTCTTCATGCTCTCGAGAGCATGAAGAGGAATCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198688
KRTAP10-6 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-6
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-1034s1c1
Sequence:CCGGCCTCCTGTGTTTCCCTCCTCTCTCGAGAGAGGAGGGAAACACAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-80s1c1
Sequence:CCGGGCCTTCCTGGTTCCTGTGACTCTCGAGAGTCACAGGAACCAGGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-515s1c1
Sequence:CCGGGCTCTGGGATTTCCTCTTCGTCTCGAGACGAAGAGGAAATCCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-539s1c1
Sequence:CCGGGCCAGCAGTCTAGCTGTGTGACTCGAGTCACACAGCTAGACTGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198688.1-752s1c1
Sequence:CCGGCTGAGGATTCCTCTTCATGCTCTCGAGAGCATGAAGAGGAATCCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)