EMAIL THIS PAGE TO A FRIEND

KRTAP10-7

keratin associated protein 10-7

15 Gene Product Result for
Synonyms: KAP10.7 KAP18.7 KRTAP18-7
UniProtKB ID: P60409, Q0VDJ8, Q70LJ2
Gene ID:
cow(783564) keratin associated protein 10-7
dog(487804) keratin associated protein 10-7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198689 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198689 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00372257 predicted 1293
2 SASI_Hs02_00372258 predicted 1193
3 SASI_Hs02_00372259 predicted 1292
4 SASI_Hs02_00372260 predicted 1244
5 SASI_Hs02_00372261 predicted 1238
6 SASI_Hs01_00038353 predicted 748
7 SASI_Hs01_00038355 predicted 1130
8 SASI_Hs02_00372262 predicted 1211
9 SASI_Hs01_00038354 predicted 744
10 SASI_Hs02_00372263 predicted 1297
11 SASI_Hs01_00038356 predicted 1136
12 SASI_Hs01_00038357 predicted 1129
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198689
KRTAP10-7 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-753s1c1
Sequence:CCGGGCTCTGATGATTCCGGTTCATCTCGAGATGAACCGGAATCATCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-749s1c1
Sequence:CCGGACCTGCTCTGATGATTCCGGTCTCGAGACCGGAATCATCAGAGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-609s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCATCACTCGAGTGATGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-388s1c1
Sequence:CCGGGCCTGTGTACTGTGTGCCTGTCTCGAGACAGGCACACAGTACACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-508s1c1
Sequence:CCGGCAAGCCTGTCTGCTCTGGGATCTCGAGATCCCAGAGCAGACAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1417s21c1
Sequence:CCGGGAGAAATGAGGGTAGACAGGTCTCGAGACCTGTCTACCCTCATTTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198689.2-1133s21c1
Sequence:CCGGTGCTGAGTGATCTCCTTAAGACTCGAGTCTTAAGGAGATCACTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1300s21c1
Sequence:CCGGAGCTGTTTCTCCAAGTCTTGACTCGAGTCAAGACTTGGAGAAACAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198689
KRTAP10-7 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-753s1c1
Sequence:CCGGGCTCTGATGATTCCGGTTCATCTCGAGATGAACCGGAATCATCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-749s1c1
Sequence:CCGGACCTGCTCTGATGATTCCGGTCTCGAGACCGGAATCATCAGAGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-609s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCATCACTCGAGTGATGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-388s1c1
Sequence:CCGGGCCTGTGTACTGTGTGCCTGTCTCGAGACAGGCACACAGTACACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-508s1c1
Sequence:CCGGCAAGCCTGTCTGCTCTGGGATCTCGAGATCCCAGAGCAGACAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1417s21c1
Sequence:CCGGGAGAAATGAGGGTAGACAGGTCTCGAGACCTGTCTACCCTCATTTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198689.2-1133s21c1
Sequence:CCGGTGCTGAGTGATCTCCTTAAGACTCGAGTCTTAAGGAGATCACTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1300s21c1
Sequence:CCGGAGCTGTTTCTCCAAGTCTTGACTCGAGTCAAGACTTGGAGAAACAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198689
KRTAP10-7 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-753s1c1
Sequence:CCGGGCTCTGATGATTCCGGTTCATCTCGAGATGAACCGGAATCATCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-749s1c1
Sequence:CCGGACCTGCTCTGATGATTCCGGTCTCGAGACCGGAATCATCAGAGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116854    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-609s1c1
Sequence:CCGGCCTGCCAATCAGGCTGCATCACTCGAGTGATGCAGCCTGATTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-388s1c1
Sequence:CCGGGCCTGTGTACTGTGTGCCTGTCTCGAGACAGGCACACAGTACACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198689.1-508s1c1
Sequence:CCGGCAAGCCTGTCTGCTCTGGGATCTCGAGATCCCAGAGCAGACAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426671    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1417s21c1
Sequence:CCGGGAGAAATGAGGGTAGACAGGTCTCGAGACCTGTCTACCCTCATTTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198689.2-1133s21c1
Sequence:CCGGTGCTGAGTGATCTCCTTAAGACTCGAGTCTTAAGGAGATCACTCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418809    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198689.2-1300s21c1
Sequence:CCGGAGCTGTTTCTCCAAGTCTTGACTCGAGTCAAGACTTGGAGAAACAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)