EMAIL THIS PAGE TO A FRIEND

KRTAP10-8

keratin associated protein 10-8

17 Gene Product Result for
Synonyms: KAP10.8 KRTAP18-8 KRTAP18.8
UniProtKB ID: P60410, A0JNW4
Gene ID:
cow(783679) keratin associated protein 10-8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198695 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142841 predicted 289
2 SASI_Hs01_00142843 predicted 412
3 SASI_Hs01_00142844 predicted 278
4 SASI_Hs01_00142846 predicted 377
5 SASI_Hs01_00142847 predicted 139
6 SASI_Hs01_00142848 predicted 74
7 SASI_Hs01_00142849 predicted 43
8 SASI_Hs01_00142842 predicted 389
9 SASI_Hs01_00142845 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198695
KRTAP10-8 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 10-8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-310s21c1
Sequence:CCGGTTCATGCTGCCAGCAGTCTAGCTCGAGCTAGACTGCTGGCAGCATGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-53s21c1
Sequence:CCGGGTGATTGCTGCATCCACCATGCTCGAGCATGGTGGATGCAGCAATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-297s21c1
Sequence:CCGGACTCCTGCACACCTTCATGCTCTCGAGAGCATGAAGGTGTGCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-138s21c1
Sequence:CCGGCCTCCTGGCAGGTGGACAATTCTCGAGAATTGTCCACCTGCCAGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-579s21c1
Sequence:CCGGTGTGCTGCCAGAAGTCTAGCTCTCGAGAGCTAGACTTCTGGCAGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-385s21c1
Sequence:CCGGTGTGTGCTGCAAGTCCAACTGCTCGAGCAGTTGGACTTGCAGCACACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-291s1c1
Sequence:CCGGGCACCGACTCCTGCACACCTTCTCGAGAAGGTGTGCAGGAGTCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-422s1c1
Sequence:CCGGTGCGTGTCCATCTGCTCTGGACTCGAGTCCAGAGCAGATGGACACGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-399s1c1
Sequence:CCGGCCAACTGCTGCAAGCCCGTGTCTCGAGACACGGGCTTGCAGCAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-84s1c1
Sequence:CCGGCCAGTGACGTGGGCCGTGTCACTCGAGTGACACGGCCCACGTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198695
KRTAP10-8 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 10-8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-310s21c1
Sequence:CCGGTTCATGCTGCCAGCAGTCTAGCTCGAGCTAGACTGCTGGCAGCATGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-53s21c1
Sequence:CCGGGTGATTGCTGCATCCACCATGCTCGAGCATGGTGGATGCAGCAATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-297s21c1
Sequence:CCGGACTCCTGCACACCTTCATGCTCTCGAGAGCATGAAGGTGTGCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-138s21c1
Sequence:CCGGCCTCCTGGCAGGTGGACAATTCTCGAGAATTGTCCACCTGCCAGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-579s21c1
Sequence:CCGGTGTGCTGCCAGAAGTCTAGCTCTCGAGAGCTAGACTTCTGGCAGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-385s21c1
Sequence:CCGGTGTGTGCTGCAAGTCCAACTGCTCGAGCAGTTGGACTTGCAGCACACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-291s1c1
Sequence:CCGGGCACCGACTCCTGCACACCTTCTCGAGAAGGTGTGCAGGAGTCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-422s1c1
Sequence:CCGGTGCGTGTCCATCTGCTCTGGACTCGAGTCCAGAGCAGATGGACACGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-399s1c1
Sequence:CCGGCCAACTGCTGCAAGCCCGTGTCTCGAGACACGGGCTTGCAGCAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-84s1c1
Sequence:CCGGCCAGTGACGTGGGCCGTGTCACTCGAGTGACACGGCCCACGTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198695
KRTAP10-8 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 10-8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370507    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-310s21c1
Sequence:CCGGTTCATGCTGCCAGCAGTCTAGCTCGAGCTAGACTGCTGGCAGCATGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-53s21c1
Sequence:CCGGGTGATTGCTGCATCCACCATGCTCGAGCATGGTGGATGCAGCAATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-297s21c1
Sequence:CCGGACTCCTGCACACCTTCATGCTCTCGAGAGCATGAAGGTGTGCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-138s21c1
Sequence:CCGGCCTCCTGGCAGGTGGACAATTCTCGAGAATTGTCCACCTGCCAGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-579s21c1
Sequence:CCGGTGTGCTGCCAGAAGTCTAGCTCTCGAGAGCTAGACTTCTGGCAGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198695.2-385s21c1
Sequence:CCGGTGTGTGCTGCAAGTCCAACTGCTCGAGCAGTTGGACTTGCAGCACACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-291s1c1
Sequence:CCGGGCACCGACTCCTGCACACCTTCTCGAGAAGGTGTGCAGGAGTCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-422s1c1
Sequence:CCGGTGCGTGTCCATCTGCTCTGGACTCGAGTCCAGAGCAGATGGACACGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-399s1c1
Sequence:CCGGCCAACTGCTGCAAGCCCGTGTCTCGAGACACGGGCTTGCAGCAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198695.1-84s1c1
Sequence:CCGGCCAGTGACGTGGGCCGTGTCACTCGAGTGACACGGCCCACGTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)