EMAIL THIS PAGE TO A FRIEND

KRTAP11-1

keratin associated protein 11-1

74 Gene Product Result for
Synonyms: HACL-1 HACL1 KAP11.1
UniProtKB ID: Q8IUC1, A1L4I8
Gene ID:
Mouse(16693) keratin associated protein 11-1
Rat(100359886) keratin associated protein 11-1
dog(100687916) keratin associated protein 11-1
cow(781604) keratin associated protein 11-1
Goat(100861173) keratin associated protein 11-1
sheep(100607967) keratin associated protein 11-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175858 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175858 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175858 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175858 Rosetta Predictions human pricing
NM_001113406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175858 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153981 predicted 593
2 SASI_Hs01_00153982 predicted 585
3 SASI_Hs01_00153983 predicted 228
4 SASI_Hs01_00153984 predicted 667
5 SASI_Hs01_00153985 predicted 271
6 SASI_Hs01_00153986 predicted 287
7 SASI_Hs01_00153987 predicted 504
8 SASI_Hs02_00369132 predicted 279
9 SASI_Hs01_00153988 predicted 279
10 SASI_Hs02_00369133 predicted 587
11 SASI_Hs01_00153989 predicted 413
12 SASI_Hs01_00153990 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307766 predicted 206
2 SASI_Mm02_00307767 predicted 223
3 SASI_Mm02_00307768 predicted 703
4 SASI_Mm02_00307769 predicted 675
5 SASI_Mm02_00307770 predicted 296
6 SASI_Mm02_00307771 predicted 261
7 SASI_Mm02_00307772 predicted 307
8 SASI_Mm02_00307773 predicted 570
9 SASI_Mm02_00307774 predicted 508
10 SASI_Mm02_00307775 predicted 691
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175858
KRTAP11-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 11-1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-341s1c1
Sequence:CCGGCTCACCTTTGTCTCTAGTGGACTCGAGTCCACTAGAGACAAAGGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-288s1c1
Sequence:CCGGCTCGACAAACTACCTGTATTTCTCGAGAAATACAGGTAGTTTGTCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-599s1c1
Sequence:CCGGGTCCCTGAATAGCTCTTCATACTCGAGTATGAAGAGCTATTCAGGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175858.2-252s1c1
Sequence:CCGGCTTCATGTGTCTCCAACCCTTCTCGAGAAGGGTTGGAGACACATGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-571s1c1
Sequence:CCGGGTTTCCAGGATCTTCCAGCATCTCGAGATGCTGGAAGATCCTGGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-285s1c1
Sequence:CCGGGCTCTCGACAAACTACCTGTACTCGAGTACAGGTAGTTTGTCGAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-749s21c1
Sequence:CCGGTGGATGTGTCCAGAAGCTTTACTCGAGTAAAGCTTCTGGACACATCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-667s21c1
Sequence:CCGGACGCTGTCTTTAGCACTCTAACTCGAGTTAGAGTGCTAAAGACAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175858
KRTAP11-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 11-1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-341s1c1
Sequence:CCGGCTCACCTTTGTCTCTAGTGGACTCGAGTCCACTAGAGACAAAGGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-288s1c1
Sequence:CCGGCTCGACAAACTACCTGTATTTCTCGAGAAATACAGGTAGTTTGTCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-599s1c1
Sequence:CCGGGTCCCTGAATAGCTCTTCATACTCGAGTATGAAGAGCTATTCAGGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175858.2-252s1c1
Sequence:CCGGCTTCATGTGTCTCCAACCCTTCTCGAGAAGGGTTGGAGACACATGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-571s1c1
Sequence:CCGGGTTTCCAGGATCTTCCAGCATCTCGAGATGCTGGAAGATCCTGGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-285s1c1
Sequence:CCGGGCTCTCGACAAACTACCTGTACTCGAGTACAGGTAGTTTGTCGAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-749s21c1
Sequence:CCGGTGGATGTGTCCAGAAGCTTTACTCGAGTAAAGCTTCTGGACACATCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-667s21c1
Sequence:CCGGACGCTGTCTTTAGCACTCTAACTCGAGTTAGAGTGCTAAAGACAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175858
KRTAP11-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 11-1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-341s1c1
Sequence:CCGGCTCACCTTTGTCTCTAGTGGACTCGAGTCCACTAGAGACAAAGGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-288s1c1
Sequence:CCGGCTCGACAAACTACCTGTATTTCTCGAGAAATACAGGTAGTTTGTCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-599s1c1
Sequence:CCGGGTCCCTGAATAGCTCTTCATACTCGAGTATGAAGAGCTATTCAGGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175858.2-252s1c1
Sequence:CCGGCTTCATGTGTCTCCAACCCTTCTCGAGAAGGGTTGGAGACACATGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175858.2-571s1c1
Sequence:CCGGGTTTCCAGGATCTTCCAGCATCTCGAGATGCTGGAAGATCCTGGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156597    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175858.2-285s1c1
Sequence:CCGGGCTCTCGACAAACTACCTGTACTCGAGTACAGGTAGTTTGTCGAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423884    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-749s21c1
Sequence:CCGGTGGATGTGTCCAGAAGCTTTACTCGAGTAAAGCTTCTGGACACATCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415890    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175858.2-667s21c1
Sequence:CCGGACGCTGTCTTTAGCACTCTAACTCGAGTTAGAGTGCTAAAGACAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)