EMAIL THIS PAGE TO A FRIEND

KRTAP12-1

keratin associated protein 12-1

33 Gene Product Result for
Synonyms: KAP12.1 KRTAP12.1
UniProtKB ID: P59990, Q0VAS3
Gene ID:
Mouse(16694) keratin associated protein 12-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010670 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010670 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010670 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181686 Rosetta Predictions human pricing
NM_010670 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178225 predicted 461
2 SASI_Hs02_00370278 predicted 440
3 SASI_Hs02_00370279 predicted 458
4 SASI_Hs02_00370280 predicted 461
5 SASI_Hs01_00178217 predicted 212
6 SASI_Hs01_00178218 predicted 361
7 SASI_Hs01_00178219 predicted 352
8 SASI_Hs01_00178220 predicted 224
9 SASI_Hs01_00178221 predicted 240
10 SASI_Hs01_00178222 predicted 327
11 SASI_Hs01_00178223 predicted 457
12 SASI_Hs01_00178224 predicted 452
13 SASI_Hs01_00178226 predicted 397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010670 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151119 predicted 440
2 SASI_Mm01_00151120 predicted 443
3 SASI_Mm01_00151121 predicted 418
4 SASI_Mm01_00151122 predicted 442
5 SASI_Mm01_00151123 predicted 390
6 SASI_Mm01_00151124 predicted 248
7 SASI_Mm01_00151125 predicted 202
8 SASI_Mm01_00151126 predicted 206
9 SASI_Mm01_00151128 predicted 204
10 SASI_Mm02_00319100 predicted 321
11 SASI_Mm01_00151127 predicted 306
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181686
KRTAP12-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 12-1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-157s21c1
Sequence:CCGGCTTCAAGCCAGCCGTGTGTGTCTCGAGACACACACGGCTGGCTTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-364s21c1
Sequence:CCGGAGATGAGGCCACACCTGTACACTCGAGTGTACAGGTGTGGCCTCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-96s21c1
Sequence:CCGGCCTGCCAGGCATCCTGTTACACTCGAGTGTAACAGGATGCCTGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-434s21c1
Sequence:CCGGAGCATGCTCAGTGAACCCTCTCTCGAGAGAGGGTTCACTGAGCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-379s21c1
Sequence:CCGGTGTACACTCCCTGGATGAGTCCTCGAGGACTCATCCAGGGAGTGTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181686
KRTAP12-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 12-1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-157s21c1
Sequence:CCGGCTTCAAGCCAGCCGTGTGTGTCTCGAGACACACACGGCTGGCTTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-364s21c1
Sequence:CCGGAGATGAGGCCACACCTGTACACTCGAGTGTACAGGTGTGGCCTCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-96s21c1
Sequence:CCGGCCTGCCAGGCATCCTGTTACACTCGAGTGTAACAGGATGCCTGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-434s21c1
Sequence:CCGGAGCATGCTCAGTGAACCCTCTCTCGAGAGAGGGTTCACTGAGCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-379s21c1
Sequence:CCGGTGTACACTCCCTGGATGAGTCCTCGAGGACTCATCCAGGGAGTGTACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181686
KRTAP12-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 12-1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-157s21c1
Sequence:CCGGCTTCAAGCCAGCCGTGTGTGTCTCGAGACACACACGGCTGGCTTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243196    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-364s21c1
Sequence:CCGGAGATGAGGCCACACCTGTACACTCGAGTGTACAGGTGTGGCCTCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181686.1-96s21c1
Sequence:CCGGCCTGCCAGGCATCCTGTTACACTCGAGTGTAACAGGATGCCTGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243199    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-434s21c1
Sequence:CCGGAGCATGCTCAGTGAACCCTCTCTCGAGAGAGGGTTCACTGAGCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243197    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181686.1-379s21c1
Sequence:CCGGTGTACACTCCCTGGATGAGTCCTCGAGGACTCATCCAGGGAGTGTACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010670
KRTAP12-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 12-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010670.1-442s1c1
Sequence:CCGGCCAAACCAGATCCTGACAGATCTCGAGATCTGTCAGGATCTGGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-208s1c1
Sequence:CCGGCCTGCTATATGCATTCCTGTTCTCGAGAACAGGAATGCATATAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-395s1c1
Sequence:CCGGGCAAGCCTGTCACCTGTAGCACTCGAGTGCTACAGGTGACAGGCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-219s1c1
Sequence:CCGGCATTCCTGTTAGATACCAGGTCTCGAGACCTGGTATCTAACAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-103s1c1
Sequence:CCGGCCATCCTGTTGTGTGTCTAGTCTCGAGACTAGACACACAACAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010670
KRTAP12-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 12-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010670.1-442s1c1
Sequence:CCGGCCAAACCAGATCCTGACAGATCTCGAGATCTGTCAGGATCTGGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-208s1c1
Sequence:CCGGCCTGCTATATGCATTCCTGTTCTCGAGAACAGGAATGCATATAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-395s1c1
Sequence:CCGGGCAAGCCTGTCACCTGTAGCACTCGAGTGCTACAGGTGACAGGCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-219s1c1
Sequence:CCGGCATTCCTGTTAGATACCAGGTCTCGAGACCTGGTATCTAACAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-103s1c1
Sequence:CCGGCCATCCTGTTGTGTGTCTAGTCTCGAGACTAGACACACAACAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010670
KRTAP12-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 12-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010670.1-442s1c1
Sequence:CCGGCCAAACCAGATCCTGACAGATCTCGAGATCTGTCAGGATCTGGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-208s1c1
Sequence:CCGGCCTGCTATATGCATTCCTGTTCTCGAGAACAGGAATGCATATAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-395s1c1
Sequence:CCGGGCAAGCCTGTCACCTGTAGCACTCGAGTGCTACAGGTGACAGGCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-219s1c1
Sequence:CCGGCATTCCTGTTAGATACCAGGTCTCGAGACCTGGTATCTAACAGGAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010670.1-103s1c1
Sequence:CCGGCCATCCTGTTGTGTGTCTAGTCTCGAGACTAGACACACAACAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)