EMAIL THIS PAGE TO A FRIEND

KRTAP12-2

keratin associated protein 12-2

20 Gene Product Result for
Synonyms: KAP12.2 KRTAP12.2
UniProtKB ID: P59991, A6NIS1, A6NMS9, Q0VAS4
Gene ID:
Rat(100361626) keratin associated protein 12-2
cow(782628) keratin-associated protein 12-2-like
cow(783717) keratin associated protein 12-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181684 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217273 predicted 216
2 SASI_Hs02_00370274 predicted 204
3 SASI_Hs01_00217274 predicted 446
4 SASI_Hs02_00370275 predicted 227
5 SASI_Hs01_00217277 predicted 448
6 SASI_Hs01_00217280 predicted 436
7 SASI_Hs02_00370276 predicted 446
8 SASI_Hs02_00370277 predicted 211
9 SASI_Hs01_00217275 predicted 506
10 SASI_Hs01_00217276 predicted 372
11 SASI_Hs01_00217278 predicted 377
12 SASI_Hs01_00217279 predicted 445
13 SASI_Hs01_00217281 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181684
KRTAP12-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 12-2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000242713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-471s21c1
Sequence:CCGGTCCTGCTGCTGAGCATGAATCCTCGAGGATTCATGCTCAGCAGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-460s1c1
Sequence:CCGGCCATCTCCTACAGTATCTCTTCTCGAGAAGAGATACTGTAGGAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-447s21c1
Sequence:CCGGAGACCCATCTCCTACAGTATCCTCGAGGATACTGTAGGAGATGGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-236s21c1
Sequence:CCGGTGTGCCCATGAGCTTCAAGTCCTCGAGGACTTGAAGCTCATGGGCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181684.2-544s21c1
Sequence:CCGGATGAGTCCTCAGTTGGTCTTCCTCGAGGAAGACCAACTGAGGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-287s21c1
Sequence:CCGGTTCTGTGTGTGTGCCTGTGAGCTCGAGCTCACAGGCACACACACAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-459s1c1
Sequence:CCGGCCCATCTCCTACAGTATCTCTCTCGAGAGAGATACTGTAGGAGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-466s1c1
Sequence:CCGGCCTACAGTATCTCTTCCTGCTCTCGAGAGCAGGAAGAGATACTGTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181684
KRTAP12-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 12-2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000242713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-471s21c1
Sequence:CCGGTCCTGCTGCTGAGCATGAATCCTCGAGGATTCATGCTCAGCAGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-460s1c1
Sequence:CCGGCCATCTCCTACAGTATCTCTTCTCGAGAAGAGATACTGTAGGAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-447s21c1
Sequence:CCGGAGACCCATCTCCTACAGTATCCTCGAGGATACTGTAGGAGATGGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-236s21c1
Sequence:CCGGTGTGCCCATGAGCTTCAAGTCCTCGAGGACTTGAAGCTCATGGGCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181684.2-544s21c1
Sequence:CCGGATGAGTCCTCAGTTGGTCTTCCTCGAGGAAGACCAACTGAGGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000242717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-287s21c1
Sequence:CCGGTTCTGTGTGTGTGCCTGTGAGCTCGAGCTCACAGGCACACACACAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-459s1c1
Sequence:CCGGCCCATCTCCTACAGTATCTCTCTCGAGAGAGATACTGTAGGAGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-466s1c1
Sequence:CCGGCCTACAGTATCTCTTCCTGCTCTCGAGAGCAGGAAGAGATACTGTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181684
KRTAP12-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 12-2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000242713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-471s21c1
Sequence:CCGGTCCTGCTGCTGAGCATGAATCCTCGAGGATTCATGCTCAGCAGCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-460s1c1
Sequence:CCGGCCATCTCCTACAGTATCTCTTCTCGAGAAGAGATACTGTAGGAGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-447s21c1
Sequence:CCGGAGACCCATCTCCTACAGTATCCTCGAGGATACTGTAGGAGATGGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-236s21c1
Sequence:CCGGTGTGCCCATGAGCTTCAAGTCCTCGAGGACTTGAAGCTCATGGGCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181684.2-544s21c1
Sequence:CCGGATGAGTCCTCAGTTGGTCTTCCTCGAGGAAGACCAACTGAGGACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000242717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181684.2-287s21c1
Sequence:CCGGTTCTGTGTGTGTGCCTGTGAGCTCGAGCTCACAGGCACACACACAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-459s1c1
Sequence:CCGGCCCATCTCCTACAGTATCTCTCTCGAGAGAGATACTGTAGGAGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181684.1-466s1c1
Sequence:CCGGCCTACAGTATCTCTTCCTGCTCTCGAGAGCAGGAAGAGATACTGTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)