EMAIL THIS PAGE TO A FRIEND

KRTAP12-3

keratin associated protein 12-3

18 Gene Product Result for
Synonyms: KRTAP12.3
Species: Human KRTAP12-3(386683)
UniProtKB ID: P60328
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198697 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198697 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049135 predicted 156
2 SASI_Hs02_00372276 predicted 220
3 SASI_Hs02_00372277 predicted 362
4 SASI_Hs02_00372278 predicted 363
5 SASI_Hs01_00049142 predicted 76
6 SASI_Hs02_00372279 predicted 223
7 SASI_Hs02_00372280 predicted 361
8 SASI_Hs02_00372281 predicted 335
9 SASI_Hs01_00049141 predicted 164
10 SASI_Hs01_00049140 predicted 365
11 SASI_Hs01_00049136 predicted 373
12 SASI_Hs01_00049137 predicted 371
13 SASI_Hs01_00049138 predicted 365
14 SASI_Hs01_00049139 predicted 376
15 SASI_Hs01_00049143 predicted 215
16 SASI_Hs01_00049144 predicted 243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198697
KRTAP12-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 12-3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-78s21c1
Sequence:CCGGCCAGCCAACCTGCTGCATACACTCGAGTGTATGCAGCAGGTTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-114s21c1
Sequence:CCGGATCCTGCTATGTGCCCGTGAGCTCGAGCTCACGGGCACATAGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-221s21c1
Sequence:CCGGTGAGCTGCAGGCCCATCATATCTCGAGATATGATGGGCCTGCAGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-230s21c1
Sequence:CCGGGGCCCATCATATATGTGACTCCTCGAGGAGTCACATATATGATGGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-238s21c1
Sequence:CCGGATATATGTGACTCCCTCTTGCCTCGAGGCAAGAGGGAGTCACATATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-225s1c1
Sequence:CCGGCTGCAGGCCCATCATATATGTCTCGAGACATATATGATGGGCCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-227s1c1
Sequence:CCGGGCAGGCCCATCATATATGTGACTCGAGTCACATATATGATGGGCCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-231s1c1
Sequence:CCGGGCCCATCATATATGTGACTCCCTCGAGGGAGTCACATATATGATGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198697
KRTAP12-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 12-3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-78s21c1
Sequence:CCGGCCAGCCAACCTGCTGCATACACTCGAGTGTATGCAGCAGGTTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-114s21c1
Sequence:CCGGATCCTGCTATGTGCCCGTGAGCTCGAGCTCACGGGCACATAGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-221s21c1
Sequence:CCGGTGAGCTGCAGGCCCATCATATCTCGAGATATGATGGGCCTGCAGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-230s21c1
Sequence:CCGGGGCCCATCATATATGTGACTCCTCGAGGAGTCACATATATGATGGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-238s21c1
Sequence:CCGGATATATGTGACTCCCTCTTGCCTCGAGGCAAGAGGGAGTCACATATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-225s1c1
Sequence:CCGGCTGCAGGCCCATCATATATGTCTCGAGACATATATGATGGGCCTGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-227s1c1
Sequence:CCGGGCAGGCCCATCATATATGTGACTCGAGTCACATATATGATGGGCCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000180398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-231s1c1
Sequence:CCGGGCCCATCATATATGTGACTCCCTCGAGGGAGTCACATATATGATGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198697
KRTAP12-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 12-3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-78s21c1
Sequence:CCGGCCAGCCAACCTGCTGCATACACTCGAGTGTATGCAGCAGGTTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-114s21c1
Sequence:CCGGATCCTGCTATGTGCCCGTGAGCTCGAGCTCACGGGCACATAGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-221s21c1
Sequence:CCGGTGAGCTGCAGGCCCATCATATCTCGAGATATGATGGGCCTGCAGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-230s21c1
Sequence:CCGGGGCCCATCATATATGTGACTCCTCGAGGAGTCACATATATGATGGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198697.2-238s21c1
Sequence:CCGGATATATGTGACTCCCTCTTGCCTCGAGGCAAGAGGGAGTCACATATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-225s1c1
Sequence:CCGGCTGCAGGCCCATCATATATGTCTCGAGACATATATGATGGGCCTGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-227s1c1
Sequence:CCGGGCAGGCCCATCATATATGTGACTCGAGTCACATATATGATGGGCCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000180398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198697.1-231s1c1
Sequence:CCGGGCCCATCATATATGTGACTCCCTCGAGGGAGTCACATATATGATGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)