EMAIL THIS PAGE TO A FRIEND

KRTAP12-4

keratin associated protein 12-4

14 Gene Product Result for
Synonyms: KRTAP12.4
Species: Human KRTAP12-4(386684)
UniProtKB ID: P60329, Q08AF5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198698 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198698 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049095 predicted 58
2 SASI_Hs01_00049096 predicted 403
3 SASI_Hs01_00049097 predicted 55
4 SASI_Hs01_00049098 predicted 130
5 SASI_Hs01_00049099 predicted 390
6 SASI_Hs01_00049100 predicted 386
7 SASI_Hs01_00049101 predicted 115
8 SASI_Hs01_00049102 predicted 402
9 SASI_Hs01_00049103 predicted 383
10 SASI_Hs02_00372282 predicted 369
11 SASI_Hs01_00049104 predicted 287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198698
KRTAP12-4 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 12-4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-130s21c1
Sequence:CCGGGAGGGCTATGGGACCTCCTGCCTCGAGGCAGGAGGTCCCATAGCCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-198s21c1
Sequence:CCGGGGTATCCACCTGCTGCCAGCCCTCGAGGGCTGGCAGCAGGTGGATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-142s21c1
Sequence:CCGGACCTCCTGCTGCTGCTCAGCCCTCGAGGGCTGAGCAGCAGCAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-119s21c1
Sequence:CCGGGCTACCCACCCGAGGGCTATGCTCGAGCATAGCCCTCGGGTGGGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-263s21c1
Sequence:CCGGCTGTGAGCTGCAAGCCTGTTTCTCGAGAAACAGGCTTGCAGCTCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198698
KRTAP12-4 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 12-4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-130s21c1
Sequence:CCGGGAGGGCTATGGGACCTCCTGCCTCGAGGCAGGAGGTCCCATAGCCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-198s21c1
Sequence:CCGGGGTATCCACCTGCTGCCAGCCCTCGAGGGCTGGCAGCAGGTGGATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-142s21c1
Sequence:CCGGACCTCCTGCTGCTGCTCAGCCCTCGAGGGCTGAGCAGCAGCAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000244706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-119s21c1
Sequence:CCGGGCTACCCACCCGAGGGCTATGCTCGAGCATAGCCCTCGGGTGGGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-263s21c1
Sequence:CCGGCTGTGAGCTGCAAGCCTGTTTCTCGAGAAACAGGCTTGCAGCTCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198698
KRTAP12-4 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 12-4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-130s21c1
Sequence:CCGGGAGGGCTATGGGACCTCCTGCCTCGAGGCAGGAGGTCCCATAGCCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-198s21c1
Sequence:CCGGGGTATCCACCTGCTGCCAGCCCTCGAGGGCTGGCAGCAGGTGGATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-142s21c1
Sequence:CCGGACCTCCTGCTGCTGCTCAGCCCTCGAGGGCTGAGCAGCAGCAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000244706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-119s21c1
Sequence:CCGGGCTACCCACCCGAGGGCTATGCTCGAGCATAGCCCTCGGGTGGGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198698.1-263s21c1
Sequence:CCGGCTGTGAGCTGCAAGCCTGTTTCTCGAGAAACAGGCTTGCAGCTCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)