EMAIL THIS PAGE TO A FRIEND

KRTAP13-1

keratin associated protein 13-1

48 Gene Product Result for
Synonyms: KAP13.1 KRTAP13.1
UniProtKB ID: Q8IUC0, Q14D20, Q3LI79
Gene ID:
Human(140258) Summary: Hair keratins and hair keratin-associated proteins (KAPs), such as KRTAP13-1, are the main structural proteins of hair fibers (Rogers et al., 2002 [PubMed 12359730]
Mouse(268905) keratin associated protein 13-1
cow(783607) keratin associated protein 13-1
cow(785121) keratin associated protein 13-1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1403461 Monoclonal Anti-KRTAP13-1 antibody produced in mouse clone 2A1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_183189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_183189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_183189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181599 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181599 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181599 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181599 Rosetta Predictions human pricing
NM_183189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181599 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370190 predicted 507
2 SASI_Hs02_00370191 predicted 509
3 SASI_Hs01_00237860 predicted 495
4 SASI_Hs02_00370192 predicted 512
5 SASI_Hs01_00237863 predicted 499
6 SASI_Hs02_00370193 predicted 508
7 SASI_Hs02_00370194 predicted 513
8 SASI_Hs02_00370195 predicted 515
9 SASI_Hs02_00370196 predicted 574
10 SASI_Hs02_00370197 predicted 566
11 SASI_Hs01_00237856 predicted 337
12 SASI_Hs01_00237857 predicted 332
13 SASI_Hs01_00237858 predicted 21
14 SASI_Hs01_00237859 predicted 48
15 SASI_Hs01_00237861 predicted 49
16 SASI_Hs01_00237862 predicted 23
17 SASI_Hs01_00237864 predicted 45
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_183189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100859 predicted 371
2 SASI_Mm01_00100860 predicted 358
3 SASI_Mm01_00100861 predicted 452
4 SASI_Mm01_00100862 predicted 344
5 SASI_Mm01_00100863 predicted 412
6 SASI_Mm01_00100864 predicted 513
7 SASI_Mm01_00100865 predicted 392
8 SASI_Mm01_00100866 predicted 354
9 SASI_Mm01_00100867 predicted 472
10 SASI_Mm02_00350300 predicted 311
11 SASI_Mm01_00100858 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_183189
KRTAP13-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 13-1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183189.1-548s1c1
Sequence:CCGGCTTCCAGTCTTGTTGACCATTCTCGAGAATGGTCAACAAGACTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-399s1c1
Sequence:CCGGCCAGTGGCTTTAGACCACAAACTCGAGTTTGTGGTCTAAAGCCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-458s1c1
Sequence:CCGGCCATCCTATGTGCCCTATAGACTCGAGTCTATAGGGCACATAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-513s1c1
Sequence:CCGGGCACTGGATCTGGATTCTATTCTCGAGAATAGAATCCAGATCCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-354s1c1
Sequence:CCGGCTCAGGGTTATGGGTCTAGAACTCGAGTTCTAGACCCATAACCCTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_183189
KRTAP13-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 13-1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183189.1-548s1c1
Sequence:CCGGCTTCCAGTCTTGTTGACCATTCTCGAGAATGGTCAACAAGACTGGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-399s1c1
Sequence:CCGGCCAGTGGCTTTAGACCACAAACTCGAGTTTGTGGTCTAAAGCCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-458s1c1
Sequence:CCGGCCATCCTATGTGCCCTATAGACTCGAGTCTATAGGGCACATAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-513s1c1
Sequence:CCGGGCACTGGATCTGGATTCTATTCTCGAGAATAGAATCCAGATCCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-354s1c1
Sequence:CCGGCTCAGGGTTATGGGTCTAGAACTCGAGTTCTAGACCCATAACCCTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_183189
KRTAP13-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 13-1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_183189.1-548s1c1
Sequence:CCGGCTTCCAGTCTTGTTGACCATTCTCGAGAATGGTCAACAAGACTGGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-399s1c1
Sequence:CCGGCCAGTGGCTTTAGACCACAAACTCGAGTTTGTGGTCTAAAGCCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-458s1c1
Sequence:CCGGCCATCCTATGTGCCCTATAGACTCGAGTCTATAGGGCACATAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-513s1c1
Sequence:CCGGGCACTGGATCTGGATTCTATTCTCGAGAATAGAATCCAGATCCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_183189.1-354s1c1
Sequence:CCGGCTCAGGGTTATGGGTCTAGAACTCGAGTTCTAGACCCATAACCCTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181599
KRTAP13-1 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 13-1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-45s1c1
Sequence:CCGGACTCACATCTCCCATCAACATCTCGAGATGTTGATGGGAGATGTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-53s1c1
Sequence:CCGGCTCCCATCAACATGTCCTACACTCGAGTGTAGGACATGTTGATGGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-491s21c1
Sequence:CCGGTCTTGCTACAGACCAACTTGTCTCGAGACAAGTTGGTCTGTAGCAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-42s1c1
Sequence:CCGGTGAACTCACATCTCCCATCAACTCGAGTTGATGGGAGATGTGAGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-32s1c1
Sequence:CCGGGTAACTCAGCTGAACTCACATCTCGAGATGTGAGTTCAGCTGAGTTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-330s1c1
Sequence:CCGGCAGTCCCTGCCAGACAACTTACTCGAGTAAGTTGTCTGGCAGGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-214s21c1
Sequence:CCGGGACATCCTATGTGGAGTCCAGCTCGAGCTGGACTCCACATAGGATGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-518s21c1
Sequence:CCGGGGCTTCTACTATTGATCATCTCTCGAGAGATGATCAATAGTAGAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181599
KRTAP13-1 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 13-1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-45s1c1
Sequence:CCGGACTCACATCTCCCATCAACATCTCGAGATGTTGATGGGAGATGTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-53s1c1
Sequence:CCGGCTCCCATCAACATGTCCTACACTCGAGTGTAGGACATGTTGATGGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-491s21c1
Sequence:CCGGTCTTGCTACAGACCAACTTGTCTCGAGACAAGTTGGTCTGTAGCAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-42s1c1
Sequence:CCGGTGAACTCACATCTCCCATCAACTCGAGTTGATGGGAGATGTGAGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-32s1c1
Sequence:CCGGGTAACTCAGCTGAACTCACATCTCGAGATGTGAGTTCAGCTGAGTTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-330s1c1
Sequence:CCGGCAGTCCCTGCCAGACAACTTACTCGAGTAAGTTGTCTGGCAGGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000444552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-214s21c1
Sequence:CCGGGACATCCTATGTGGAGTCCAGCTCGAGCTGGACTCCACATAGGATGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-518s21c1
Sequence:CCGGGGCTTCTACTATTGATCATCTCTCGAGAGATGATCAATAGTAGAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181599
KRTAP13-1 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 13-1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-45s1c1
Sequence:CCGGACTCACATCTCCCATCAACATCTCGAGATGTTGATGGGAGATGTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-53s1c1
Sequence:CCGGCTCCCATCAACATGTCCTACACTCGAGTGTAGGACATGTTGATGGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-491s21c1
Sequence:CCGGTCTTGCTACAGACCAACTTGTCTCGAGACAAGTTGGTCTGTAGCAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-42s1c1
Sequence:CCGGTGAACTCACATCTCCCATCAACTCGAGTTGATGGGAGATGTGAGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-32s1c1
Sequence:CCGGGTAACTCAGCTGAACTCACATCTCGAGATGTGAGTTCAGCTGAGTTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181599.1-330s1c1
Sequence:CCGGCAGTCCCTGCCAGACAACTTACTCGAGTAAGTTGTCTGGCAGGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000444552    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-214s21c1
Sequence:CCGGGACATCCTATGTGGAGTCCAGCTCGAGCTGGACTCCACATAGGATGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181599.2-518s21c1
Sequence:CCGGGGCTTCTACTATTGATCATCTCTCGAGAGATGATCAATAGTAGAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)