EMAIL THIS PAGE TO A FRIEND

KRTAP13-2

keratin associated protein 13-2

52 Gene Product Result for
Synonyms: KAP13-2
UniProtKB ID: Q52LG2
Gene ID:
Rat(501765) keratin associated protein 13-2
dog(100687365) keratin associated protein 13-2
Horse(100065250) keratin associated protein 13-2
cow(785221) keratin associated protein 13-2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103711 Anti-KRTAP13-2 (16-30) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181621 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181621 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181621 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181621 Rosetta Predictions human pricing
NM_001109325 Rosetta Predictions rat pricing
XM_577165 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181621 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237559 predicted 286
2 SASI_Hs01_00237560 predicted 588
3 SASI_Hs01_00237561 predicted 587
4 SASI_Hs01_00237562 predicted 519
5 SASI_Hs01_00237563 predicted 566
6 SASI_Hs01_00237564 predicted 570
7 SASI_Hs01_00237565 predicted 511
8 SASI_Hs01_00237566 predicted 392
9 SASI_Hs01_00237567 predicted 578
10 SASI_Hs01_00237568 predicted 399
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247314 predicted 518
2 SASI_Rn02_00247315 predicted 674
3 SASI_Rn02_00247316 predicted 466
4 SASI_Rn02_00247317 predicted 752
5 SASI_Rn02_00247318 predicted 735
6 SASI_Rn02_00247319 predicted 496
7 SASI_Rn02_00247320 predicted 583
8 SASI_Rn02_00247321 predicted 523
9 SASI_Rn02_00247322 predicted 548
10 SASI_Rn02_00247323 predicted 646
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_577165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00152983 predicted 470
2 SASI_Rn01_00152984 predicted 417
3 SASI_Rn01_00152985 predicted 430
4 SASI_Rn01_00152986 predicted 446
5 SASI_Rn01_00152987 predicted 457
6 SASI_Rn01_00152988 predicted 478
7 SASI_Rn01_00152989 predicted 487
8 SASI_Rn01_00152990 predicted 472
9 SASI_Rn01_00152991 predicted 488
10 SASI_Rn01_00152992 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181621
KRTAP13-2 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 13-2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000116912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181621.2-570s1c1
Sequence:CCGGGAGCTGTTATCATAGGCATTTCTCGAGAAATGCCTATGATAACAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-478s1c1
Sequence:CCGGCCTTGTTACAGACCAGCCTATCTCGAGATAGGCTGGTCTGTAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-267s1c1
Sequence:CCGGCAGTCCTTGCAAGACGACTTACTCGAGTAAGTCGTCTTGCAAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-494s1c1
Sequence:CCGGCCTATGGATCAACCTTCTGCACTCGAGTGCAGAAGGTTGATCCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-416s1c1
Sequence:CCGGCCCTCGGCTATGGATCTGGATCTCGAGATCCAGATCCATAGCCGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181621
KRTAP13-2 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 13-2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000116912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181621.2-570s1c1
Sequence:CCGGGAGCTGTTATCATAGGCATTTCTCGAGAAATGCCTATGATAACAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-478s1c1
Sequence:CCGGCCTTGTTACAGACCAGCCTATCTCGAGATAGGCTGGTCTGTAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-267s1c1
Sequence:CCGGCAGTCCTTGCAAGACGACTTACTCGAGTAAGTCGTCTTGCAAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-494s1c1
Sequence:CCGGCCTATGGATCAACCTTCTGCACTCGAGTGCAGAAGGTTGATCCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-416s1c1
Sequence:CCGGCCCTCGGCTATGGATCTGGATCTCGAGATCCAGATCCATAGCCGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181621
KRTAP13-2 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 13-2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000116912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_181621.2-570s1c1
Sequence:CCGGGAGCTGTTATCATAGGCATTTCTCGAGAAATGCCTATGATAACAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-478s1c1
Sequence:CCGGCCTTGTTACAGACCAGCCTATCTCGAGATAGGCTGGTCTGTAACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-267s1c1
Sequence:CCGGCAGTCCTTGCAAGACGACTTACTCGAGTAAGTCGTCTTGCAAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-494s1c1
Sequence:CCGGCCTATGGATCAACCTTCTGCACTCGAGTGCAGAAGGTTGATCCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181621.2-416s1c1
Sequence:CCGGCCCTCGGCTATGGATCTGGATCTCGAGATCCAGATCCATAGCCGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)