EMAIL THIS PAGE TO A FRIEND

KRTAP13-3

keratin associated protein 13-3

14 Gene Product Result for
Synonyms: KAP13.3
UniProtKB ID: Q3SY46, Q3LI78
Gene ID:
cow(785155) keratin associated protein 13-3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301973 ANTI-KRTAP13-3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181622 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181622 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181622 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181622 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181622 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132560 predicted 243
2 SASI_Hs01_00132561 predicted 246
3 SASI_Hs01_00132562 predicted 264
4 SASI_Hs01_00132565 predicted 258
5 SASI_Hs01_00132566 predicted 268
6 SASI_Hs01_00132567 predicted 259
7 SASI_Hs01_00132568 predicted 267
8 SASI_Hs01_00132559 predicted 244
9 SASI_Hs01_00132563 predicted 246
10 SASI_Hs01_00132564 predicted 246
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181622
KRTAP13-3 MISSION shRNA Bacterial Glycerol Stock
keratin associated protein 13-3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-186s1c1
Sequence:CCGGGCCCAACAGCTGTCAGACATTCTCGAGAATGTCTGACAGCTGTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-193s1c1
Sequence:CCGGAGCTGTCAGACATTGTGTGTTCTCGAGAACACACAATGTCTGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-50s1c1
Sequence:CCGGGTTACTTGCACTACCCAGGCTCTCGAGAGCCTGGGTAGTGCAAGTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-264s1c1
Sequence:CCGGCTGCAATTCTTGCCTGACTATCTCGAGATAGTCAGGCAAGAATTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-250s1c1
Sequence:CCGGAGGACTCACATGCTCTGCAATCTCGAGATTGCAGAGCATGTGAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-305s21c1
Sequence:CCGGTTGGATCCAATAGCTGCTGCTCTCGAGAGCAGCAGCTATTGGATCCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-469s21c1
Sequence:CCGGTGGTTCCATTCATCTTGTTATCTCGAGATAACAAGATGAATGGAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181622
KRTAP13-3 MISSION shRNA shRNA Plasmid DNA
keratin associated protein 13-3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-186s1c1
Sequence:CCGGGCCCAACAGCTGTCAGACATTCTCGAGAATGTCTGACAGCTGTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-193s1c1
Sequence:CCGGAGCTGTCAGACATTGTGTGTTCTCGAGAACACACAATGTCTGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-50s1c1
Sequence:CCGGGTTACTTGCACTACCCAGGCTCTCGAGAGCCTGGGTAGTGCAAGTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-264s1c1
Sequence:CCGGCTGCAATTCTTGCCTGACTATCTCGAGATAGTCAGGCAAGAATTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000108421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-250s1c1
Sequence:CCGGAGGACTCACATGCTCTGCAATCTCGAGATTGCAGAGCATGTGAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-305s21c1
Sequence:CCGGTTGGATCCAATAGCTGCTGCTCTCGAGAGCAGCAGCTATTGGATCCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-469s21c1
Sequence:CCGGTGGTTCCATTCATCTTGTTATCTCGAGATAACAAGATGAATGGAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181622
KRTAP13-3 MISSION shRNA Lentiviral Transduction Particles
keratin associated protein 13-3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-186s1c1
Sequence:CCGGGCCCAACAGCTGTCAGACATTCTCGAGAATGTCTGACAGCTGTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-193s1c1
Sequence:CCGGAGCTGTCAGACATTGTGTGTTCTCGAGAACACACAATGTCTGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-50s1c1
Sequence:CCGGGTTACTTGCACTACCCAGGCTCTCGAGAGCCTGGGTAGTGCAAGTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-264s1c1
Sequence:CCGGCTGCAATTCTTGCCTGACTATCTCGAGATAGTCAGGCAAGAATTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000108421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181622.1-250s1c1
Sequence:CCGGAGGACTCACATGCTCTGCAATCTCGAGATTGCAGAGCATGTGAGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-305s21c1
Sequence:CCGGTTGGATCCAATAGCTGCTGCTCTCGAGAGCAGCAGCTATTGGATCCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181622.1-469s21c1
Sequence:CCGGTGGTTCCATTCATCTTGTTATCTCGAGATAACAAGATGAATGGAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)